Informations

Télécharger des gènes de levure spécifiques de manière automatisée ?

Télécharger des gènes de levure spécifiques de manière automatisée ?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

J'ai 6 gènes de Candida albicans levure à savoirorf19.723,orf19.5908,orf19.610,orf19.2119,orf19.4998etorf19.4056. Et j'ai trouvé les gènes orthologues correspondants sur le site Web du Broad Institute de 16 autres espèces de levure. J'ai donc tous les noms de gènes. Maintenant, comment pourrais-je spécifiquement télécharger ces gènes et d'où puis-je le faire, de préférence de manière automatisée ?

Existe-t-il également une convention de nommage standard? Parce que les noms ORF donnés ont aussi d'autres noms comme BCR1, EFG1 et NDT80.

La liste des noms de gènes que j'ai :

Les orthologues de C. Albicans avec S. cerevisiae orf19.2119 YHR124W orf19.4998 YBR033W YKL034W orf19.5908 YBR083W orf19.610 YMR016C YKL043W orf19.723 AUCUN orf19.4056 YMR136W Les orthologues d'Albicans avec C.1919. -g1.1 orf19.4998 spar197-g23.1 spar324-g3.1 orf19.5908 spar200-g4.1 orf19.610 spar184-g1.1 spar324-g10.1 orf19.723 AUCUN orf19.4056 spar165-g2.1 Les orthologues de C. Albicans avec S. mikatae orf19.2119 AUCUN orf19.4998 smik146-g12.1 smik109-g17.1 orf19.5908 smik83-g2.1 orf19.610 smik571-g2.1 smik109-g10.1 orf19. 723 AUCUN orf19.4056 smik1535-g1.1 Les orthologues de C. Albicans avec S. bayanus orf19.2119 sbayc514-g9.1 orf19.4998 sbayc611-g22.1 sbayc652-g20.1 orf19.5908 sbayc678-g131.1 orf19 .610 sbayc638-g23.1 sbayc652-g27.1 orf19.723 AUCUN orf19.4056 sbayc657-g41.1 Les orthologues de C. Albicans avec S. castellii orf19.2119 Scas697.24 orf19.4998 Scas625.4 orf19.5908 Scas718 .27 Scas635.12 orf19.610 Scas106.1 Scas709.52 Scas625.8 orf19.723 AUCUN orf19.4056 Scas680.22 d Les orthologues de C. Albicans avec C. glabrata orf19.2119 CAGL0L13090g orf19.4998 CAGL0L01947g orf19.5908 CAGL0M01716g CAGL0F04081g orf19.610 CAGL0M07634g CAGL0L01771g orf19.7023 AUCUN CAg90 orf19.610 CAGL0M07634g 2119 SAKL0E11330g orf19.4998 SAKL0A09812g orf19.5908 SAKL0B06578g orf19.610 SAKL0D13442g orf19.723 SAKL0A03476g orf19.4056 SAKL0E04862g Les orthologues de C. albicans avec K. lactis orf19.2119 KLLA0F24420g orf19.4998 KLLA0F25674g orf19.5908 KLLA0E12507g orf19.610 KLLA0F04840g orf19. 723 AUCUN orf19.4056 KLLA0F17116g Les orthologues de C. Albicans avec A. gossypii orf19.2119 AGR347W orf19.4998 AFR275W orf19.5908 AER177W orf19.610 ABR055C orf19.723 AUCUN orf19.4056 ADR249W. orf19.2119 Kwal33.14699 orf19.4998 Kwal26.8099 orf19.5908 Kwal27.12423 orf19.610 Kwal26.8176 orf19.723 AUCUN orf19.4056 Kwal47.17849 Les orthologues de C. Albicans avec C. tropicalis orf19.2119 CTRG01097.3 orf19.4998 CTRG03636.3 orf19.5908 CTRG02294.3 orf19.610 AUCUN orf19.723 CTRG00608.3 orf19.4056 CTRG04523.3 Les orthologues de C. Albicans avec L. elongosporus orf19.2119 LELG01178 orf19.4998 AUCUN orf19.5908 LELG02666 orf19.610 LELG05390 orf19.723 LELG03123 orf19.4056 LELG01761 Les orthologues de C. albicans avec C. parapsilosis orf19.2119 CPAG04608 orf19.4998 AUCUN orf19.5908 CPAG01691 orf19.610 CPAG00178 orf19.723 CPAG00564 orf19.4056 orf19.5908 CPAG01691 orf19.610 CPAG00178 orf19.723 CPAG00564 orf19.4056 D. hansenii orf19.2119 DEHA2A07282g orf19.4998 AUCUN orf19.5908 DEHA2G13794g orf19.610 DEHA2E10978g orf19.723 DEHA2E05984g orf19.4056 DEHA2E07172g DEHA2F25916g 5908 PGUG04378.1 orf19.610 PGUG03651.1 orf19.723 PGUG05571.1 orf19.4056 PGUG05533.1 Les orthologues de C. Albicans avec C. lusitaniae orf19.2119 CLUG00404 orf19.4998 AUCUN orf19.5908 CLUG04694 orf19.610 CLUG190 723 CLUG00627 orf19.4056 CLUG05535

Ces séquences n'ont pas d'i.d. standard. Les informations contenues dans la base de données du génome de Saccharomyces sont également obsolètes (2005) et ne disposent pas de ces identifiants.

Ces séquences peuvent être trouvées ici (dans le même site).

Chaque espèce a un nom court :

ORGANISME Nom abrégé S.cerevesiae Scer S. bayanus Sbay S. paradoxus Spar A. gossypii Agos… et ainsi de suite.

Première lettre du nom de genre en majuscule + 3 premières lettres du nom d'espèce en minuscule.

Le fichier fasta (pour tous les ORF) est :
www.broadinstitute.org/regev/orthogroups/nt/.fasta

De là, vous pouvez utiliser grep pour récupérer la séquence.

Donc, si vous avez enregistré des noms courts et des noms de gènes dans deux fichiers séparés, vous pouvez faire quelque chose comme ceci :

pour le nom abrégé dans 'cat shortname.txt' ; faire wget -O tmp.fa "http://www.broadinstitute.org/regev/orthogroups/nt/"$shortname.fasta ; grep -A 1 -f ids.txt tmp.fa >> $shortname"_Select.fa" ; terminé

OK, la première étape doit être de mapper tous ces identifiants sur la même base de données. Essayez d'utiliser http://uniprot.org si vous voulez d'autres séquences de protéines, recherchez chacune d'entre elles et trouvez l'ID Refseq correspondant. Étant donné que vous disposez d'identifiants provenant de plusieurs bases de données, vous devrez peut-être les rechercher individuellement sur Google. Si vous connaissez le type d'ID de chaque identifiant que vous possédez, vous pouvez utiliser un outil comme le convertisseur de nom de gène de DAVID pour l'automatiser.

Une fois que vous avez une liste d'identifiants de la même base de données, enregistrez-les dans un fichier (un identifiant par ligne). Ensuite, pour les accessions UniProt, vous pouvez obtenir la séquence protéique FASTA en exécutant :

tout en lisant le nom ; faire wget -O - http://unipro.org/$name.fasta; fait 

Pour les ID RefSeq, vous pouvez utiliser l'outil de récupération par lots de Entrez.


Compacter un bras chromosomique de levure synthétique

La redondance est une caractéristique commune des génomes, vraisemblablement pour assurer une croissance robuste dans des conditions différentes et changeantes. Le compactage du génome, en supprimant les séquences non essentielles dans des conditions données, offre une nouvelle façon de comprendre les principes fondamentaux de la vie. Le système de réarrangement et de modification chromosomique synthétique par évolution médiée par loxP (SCRaMbLE) est une caractéristique unique implantée dans le génome synthétique de la levure (Sc2.0), qui est proposé comme un outil efficace pour la minimisation du génome. Alors que le projet Sc2.0 touche à sa fin, nous avons commencé à explorer l'application du système SCRaMbLE dans le compactage du génome.

Résultats

Nous développons une méthode appelée compactage du génome basé sur SCRaMbLE (SGC) et démontrons qu'un bras chromosomique synthétique (synXIIL) peut être efficacement réduit. La matrice de gènes essentiels épisomiques pré-introduite améliore considérablement la capacité de compactage de SGC, non seulement en permettant la suppression de gènes non essentiels situés dans le gène essentiel contenant des unités loxPsym, mais également en permettant d'éliminer davantage de séquences chromosomiques en un seul processus SGC. Un compactage supplémentaire est obtenu par SGC itérative, révélant qu'au moins 39 des 65 gènes non essentiels dans synXIIL peuvent être retirés collectivement sans affecter la viabilité cellulaire à 30 ° C dans un milieu riche. Environ 40 % de la séquence synthétique, codant pour 28 gènes, s'avère indispensable pour la croissance cellulaire à 30 °C en milieu riche et plusieurs gènes dont les fonctions sont nécessaires dans des conditions spécifiées sont identifiés.

Conclusion

Nous développons le SGC itératif à l'aide d'eArray en tant qu'outil générique mais efficace pour compacter le génome synthétique de la levure.


Résumé

Nous décrivons la conception complète d'un génome eucaryote synthétique, Sc2.0, un Saccharomyces cerevisiae génome réduit en taille de près de 8 %, avec 1,1 mégabases du génome synthétique supprimée, insérée ou modifiée. La conception des chromosomes Sc2.0 a été mise en œuvre avec BioStudio, un framework open source développé pour la conception du génome eucaryote, qui coordonne les modifications de conception des échelles nucléotidiques aux échelles génomiques et applique le contrôle de version pour suivre systématiquement les modifications. Pour réaliser une synthèse complète du génome Sc2.0, les chromosomes synthétiques individuels construits par les équipes du Consortium Sc2.0 du monde entier seront consolidés en une seule souche par «intercroisement d'endoréduplication». Les génomes synthétisés chimiquement comme Sc2.0 sont entièrement personnalisables et permettent aux expérimentateurs de poser des questions autrement insolubles sur la structure, la fonction et l'évolution des chromosomes avec une stratégie de conception ascendante.

L'objectif du projet Sc2.0 est la synthèse complète d'un génome conçu sur mesure pour un organisme modèle eucaryote afin de servir de plate-forme pour les études systématiques des chromosomes eucaryotes. L'effort mondial Sc2.0 pour construire des chromosomes est réparti sur de nombreux endroits. Cet aspect unique de Sc2.0 a motivé la conception d'aspects du logiciel BioStudio qui permettent une stratégie d'assemblage commune et appliquent un langage partagé pour décrire à la fois les chromosomes conçus intermédiaires et les souches vivantes.

Le point de départ de la séquence du génome Sc2.0 est le Saccharomyces cerevisiae séquence (1, 2). Les principes guidant la conception du génome Sc2.0 équilibrent le désir de maintenir un phénotype de « type sauvage » tout en introduisant une flexibilité génétique inductible et en minimisant les sources d'instabilité génomique résultant de la nature répétitive de l'ADN de levure natif. Les chromosomes Sc2.0 sont donc conçus pour coder un code génétique légèrement modifié dans lequel tous les codons stop TAG sont changés en TAA (3) pour inclure les sites loxPsym qui sous-tendent le système d'évolution inductible SCRaMbLE (4, 5) et pour manquer d'éléments répétés, transférer des gènes d'ARN (ARNt) (relocalisés dans un « néochromosome »), et de nombreux introns. De plus, de courtes séquences recodées dans des cadres de lecture ouverts (ORF), appelés PCRTags, facilitent un test basé sur la réaction en chaîne par polymérase (PCR) pour distinguer l'ADN de type sauvage de l'ADN synthétique (57). Enfin, les substitutions de bases dans les ORF introduisent ou suppriment des sites de reconnaissance enzymatique pour faciliter l'assemblage de chromosomes synthétiques.

Pour mettre en œuvre la refonte Sc2.0 à l'échelle du génome, il était nécessaire d'établir non seulement un pipeline d'assemblage d'ADN générique pour des chromosomes synthétiques de 200 kb à >1 Mb, mais également des outils de calcul flexibles. Nous avons maintenant terminé la conception du génome Sc2.0 et décrivons l'effort ici. À ce jour, 6,5 chromosomes concepteurs Sc2.0 ont été construits dans des souches discrètes (5, 813), et ici, nous montrons la consolidation de 2,5 chromosomes synthétiques en une seule souche. Les phénotypes de type quasi-sauvage des souches synthétiques sont cohérents avec une tolérance généralisée des caractéristiques de conception et indiquent la robustesse globale de S. cerevisiae à la manipulation génétique.


Construire des allèles mutants

La levure humanisée fournit un contexte simplifié pour l'analyse de la fonction des gènes humains qui se prête particulièrement aux approches systématiques et à haut débit. Pour utiliser le système humanisé, des sources d'allèles intéressants de gènes humains sont nécessaires. Les approches initiales se sont concentrées sur les allèles connus liés aux maladies humaines, mais se sont récemment étendues pour englober les « variantes d'importance inconnue » et toutes les substitutions possibles d'acides aminés. La technique d'analyse mutationnelle profonde mise au point par Fowler et Fields (14) permet la génération d'allèles de substitution d'acides aminés uniques à la densité la plus élevée possible. Lorsqu'il est connecté à des tests phénotypiques, le balayage mutationnel profond révèle des allèles mutants avec les propriétés souhaitées, généralement une sorte de perte de fonction. Hamza et al. (5) écran FEN1 allèles qui ont été conçus pour inactiver la catalyse mais pas la liaison à l'ADN, et étaient donc susceptibles d'entraîner le piégeage des complexes FEN1-ADN. Le balayage mutationnel profond pourrait être utilisé pour séparer les mutants fonctionnels qui perdent leur activité catalytique mais qui conservent les interactions protéine-ADN ou protéine-protéine (15), exactement le type de mutants de piégeage que Hamza et al. modèle avec leur FEN1 allèles.


Biologie des systèmes de levure : notre meilleur coup pour modéliser une cellule

Le prix Edward Novitski de la Genetics Society of America reconnaît un niveau extraordinaire de créativité et d'ingéniosité intellectuelle dans la résolution de problèmes importants dans la recherche génétique. Le lauréat 2014, Charles Boone, s'est hissé au sommet de la discipline émergente de la biologie des systèmes postgénomiques en se concentrant sur la cartographie mondiale des réseaux d'interaction génétique. Boone a inventé la technologie de matrice génétique synthétique (SGA), qui fournit une méthode automatisée pour croiser des milliers de souches portant des mutations précises et cartographier les interactions génétiques de levure à grande échelle. Ces cartes de réseau offrent aux chercheurs un schéma de câblage fonctionnel de la cellule, qui regroupe les gènes dans des voies spécifiques et révèle des connexions fonctionnelles.

Il est sûr de dire que la levure est mieux comprise que toute autre cellule. Des centaines de laboratoires dans le monde étudient depuis des décennies ce puissant modèle génétique sous divers angles, et nous avons fait des progrès spectaculaires dans la compréhension de la plupart des voies et des fonctions cellulaires. Néanmoins, aucun de nous ne prétendrait savoir comment fonctionne réellement la cellule de levure.

Le problème majeur est que la masse toujours croissante d'informations biologiques détaillées n'a pas encore été rassemblée en une image complète et intégrée. En fin de compte, si nous voulons modéliser la vie au niveau d'une cellule entière, nous devons comprendre comment tous ses composants sont connectés et coordonnés. Ce n'est qu'alors que nous pourrons prédire les réponses physiologiques à une perturbation génétique ou environnementale spécifique. Bien qu'il s'agisse d'une tâche ardue, je pense que la modélisation de la cellule est à notre portée et, bien que je sois partial, je pense que la levure en herbe offre notre meilleure chance de relever ce défi.

Le premier pas décisif vers une compréhension globale d'une cellule a été fait par l'équipe internationale d'André Goffeau, qui a assemblé la première séquence d'un eucaryote ( Goffeau et al. 1996). Avoir une image complète du génome de la levure a ouvert la porte à des approches de génomique fonctionnelle qui étaient auparavant à peine imaginables. En tant que stagiaire postdoctoral à l'Université de l'Oregon, je me souviens avoir été époustouflé par ce qui semblait alors une idée absolument folle. Au cours du dîner, notre conférencier invité, Stan Fields, a décrit comment il prévoyait de cloner chaque gène de levure pour tenter de tester toutes les paires de protéines de levure possibles, couvrant une matrice entière de 6 000 × 6 000, pour les interactions physiques à l'aide de son test à deux hybrides ( Uetz et al. 2000). Dans le même temps, plusieurs groupes de levures différents, tous deux académiques ( Derisi 1997 Eisen et al. 1998) et les entreprises commerciales ( Dimster-Denk et al. 1999 Hugues et al. 2000), ont été les pionniers de l'analyse de l'expression des gènes à l'échelle du génome pour révéler des réponses transcriptionnelles globales. Pendant ce temps, des criblages phénotypiques systématiques ont été rendus possibles par des collections de mutants à l'échelle du génome, assemblées sous la forme de bibliothèques de mutagenèse par transposon (Ross-Macdonald et al. 1999) et les collections de suppression ( Winzeler et al. 1999 Giever et al. 2002). Prises ensemble, ces approches au niveau des systèmes ont fourni une nouvelle façon intégrée de penser la science, qui a inspiré notre forme automatisée de génétique de la levure appelée analyse par matrice génétique synthétique (SGA) ( Tong et al. 2001), une méthodologie conçue pour cartographier les interactions génétiques à l'échelle du génome ( Tong et al. 2004).

Exploiter l'expertise et la puissance de l'ensemble de la communauté de recherche sur la levure de manière coordonnée représenterait la version biologique ultime de l'approche au niveau des systèmes de la science sophistiquée du CERN.

-C.B.

Le succès de la génomique fonctionnelle dépend d'équipes multidisciplinaires capables de concevoir, de mettre en œuvre et d'interpréter des stratégies expérimentales à grande échelle. L'analyse informatique requise pour traiter et quantifier les données émergentes fait partie intégrante de ce processus. Je pense que la culture de partage ouvert des réactifs et des idées de la communauté de la levure nous a tous préparés à adopter ce nouveau style de science largement collaborative. Le développement de la Saccharomyces La base de données du génome (SGD) ( Cherry 1998) a également joué un rôle important dans la construction de cette culture en libre accès en assemblant et en organisant les données d'études ciblées et à grande échelle. Grâce à son équipe d'experts, SGD gère également les données dérivées principalement d'études ciblées pour générer des annotations d'ontologie génétique (GO) lisibles par machine pour les gènes de levure (Ashburner et al. 2000). Bien que cette annotation détaillée soit essentielle pour communiquer notre compréhension de la fonction des gènes, elle fournit également un étalon-or pour quantifier les informations fonctionnelles dérivées d'études à grande échelle, qui peuvent varier en qualité et en ampleur. Ainsi, SGD comble un fossé entre des études ciblées très précises, mais biaisées, et des études mondiales, avec le large potentiel d'aborder les rôles de gènes auparavant non caractérisés et de cartographier de nouvelles connexions fonctionnelles entre des processus apparemment sans rapport.

Précisément parce qu'il coordonne toutes les données expérimentales sur la levure et les rend accessibles au plus grand nombre, le SGD est devenu la pièce maîtresse de notre domaine. Peut-être plus important encore, grâce à SGD, la communauté de la levure a cartographié un modèle très réussi pour aborder l'annotation fonctionnelle d'un génome. En fait, si je dirigeais d'importantes sources de financement, j'investirais massivement dans la mise en œuvre d'une stratégie similaire de SGD pour le génome humain (c'est à dire., HGD). Ayant visité le site Web de SGD presque tous les jours depuis sa création, je ne peux qu'imaginer qu'un homologue HGD aurait un impact incommensurable sur la génétique humaine et notre compréhension du génome humain.

Au lendemain de la récente crise financière, nos gouvernements réduisent le financement de la science fondamentale et, malheureusement, le soutien à un projet comme HGD est peu probable. Ironiquement, juste au moment où nous commençons à faire de réels progrès vers une compréhension mécaniste du fonctionnement de la vie, les ressources consacrées à la recherche fondamentale diminuent. Dans cet esprit, il semble évident que HGD s'intégrerait parfaitement dans le portefeuille d'une société d'information privée. L'assemblage de HGD est forcément rentable car il constitue à terme la base de la médecine de précision. Dans le passé, nous nous inquiétions tous des intérêts des entreprises possédant la séquence du génome humain et, ironiquement, il semble que dans l'environnement actuel, le secteur privé soit notre seul espoir de financer un projet comme HGD.

L'analyse du réseau génétique SGA a fourni à notre groupe de recherche l'opportunité de s'interfacer avec SGD, BioGRID (Stark et al. 2006), et d'autres bases de données pour contribuer à l'annotation fonctionnelle du génome de la levure. Brenda Andrews, Michael Costanzo et moi-même avons travaillé ensemble pour assembler et mettre en œuvre la méthodologie et les réactifs nécessaires pour cartographier un réseau d'interaction génétique complet pour la levure. Nos principaux collaborateurs informatiques, Chad Myers et son équipe, sont en grande partie responsables de trouver comment extraire des informations significatives de notre ensemble de données à grande échelle, mais relativement bruyant. Avec l'analyse SGA, nous quantifions à la fois les interactions génétiques négatives et positives, où les doubles mutants sont notés comme se développant pire ou mieux que prévu, respectivement ( Baryshnikova et al. 2010). Notre assemblage d'un réseau génétique mondial composé de centaines de milliers d'interactions génétiques met en évidence la puissance de la génétique combinatoire pour identifier les voies, délimiter comment elles fonctionnent ensemble pour contrôler les fonctions cellulaires essentielles et cartographier un schéma de câblage fonctionnel pour la cellule ( Costanzo et al. 2010).

Il y a plus de 10 ans, Lee Hartwell et ses collègues ont suggéré que les interactions génétiques pourraient jouer un rôle clé dans notre capacité à interpréter la relation génotype-phénotype pour un individu (Hartman et al. 2001). Cette idée fait maintenant son chemin avec les deux levures ( Bloom et al. 2013) et les généticiens humains ( Zuk et al. 2012) et deviendra probablement de plus en plus pertinent avec le séquençage imminent de millions de génomes humains individuels. Bien que cela reste à prouver, étant donné l'étendue et l'étendue du réseau génétique mondial de la levure, nous pouvons très certainement anticiper que les interactions génétiques et leurs réseaux doivent sous-tendre une proportion importante des phénotypes de maladies humaines. Heureusement, il existe quelques règles simples associées à la structure et à la topologie des réseaux génétiques qui semblent être généralement conservées. En particulier, les gènes au sein des voies se comportent souvent de manière cohérente, connectés à d'autres voies par un ensemble cohérent d'interactions positives ou négatives. En effet, en extrapolant ces règles à partir du réseau génétique de la levure, l'équipe informatique du Tchad semble avoir développé des méthodes avec une puissance statistique suffisante pour détecter des signaux d'interaction génétique significatifs à partir d'études d'association à l'échelle du génome (GWAS) chez l'homme. Ainsi, les propriétés fondamentales des réseaux génétiques que nous apprenons de la levure peuvent être critiques pour l'interprétation de nos propres génomes.

Les méthodes mises au point par Charlie Boone se sont avérées être la source la plus riche d'interactions biologiques connues à ce jour, et sont à la base des « interactomes » qui sont à l'origine d'une grande partie de l'expérimentation et de la pensée génétique contemporaines.

—Jasper Rine, Université de Californie, Berkeley

Les technologies au niveau des systèmes développées dans la levure et les données à l'échelle du génome qui en résultent ont alimenté le domaine de la bioinformatique et de la biologie computationnelle. En effet, ce n'est qu'avec un traitement informatique détaillé des données de génomique fonctionnelle que nous pouvons réaliser leur plein potentiel. Cependant, pour construire un modèle précis et complet de la cellule, nous devons continuer à repousser les limites de la génomique fonctionnelle et de sa bioinformatique. Je pense que la prochaine étape nécessite un nouveau mode opératoire où les données sont collectées au niveau communautaire plutôt que par des laboratoires individuels. Avec toutes nos entreprises de recherche travaillant exactement sur la même cellule, ce prochain niveau de science hautement coordonnée est tout à fait réalisable. Notre souche de référence, S288c, nous offre une continuité génétique, ce qui signifie que les données quantitatives à l'échelle du génome dérivées de différents laboratoires du monde entier peuvent être compilées et assemblées dans un format unifié. Étant donné que chaque laboratoire possède une expertise dans des voies spécifiques et peut donc concevoir des lectures précises spécifiques à une voie, notre communauté a le potentiel de coordonner une analyse quantitative de la plupart des voies sous l'influence d'un ensemble de perturbations génétiques à l'échelle du génome et d'un ensemble standardisé de facteurs environnementaux. conditions. On ne sait pas exactement comment procéder, mais je soupçonne que ce mode d'analyse pourrait être réalisé grâce à un certain nombre de différents types d'expériences. Une approche évidente consiste à combiner la génétique automatisée de la levure SGA avec le tri cellulaire ou le criblage à haute teneur pour quantifier l'activité de rapporteurs de diagnostic dans un ensemble complet de mutants ( Jonikas et al. 2009 Vizeacoumar et al. 2010). Bien qu'il y aura sûrement des défis techniques à surmonter, exploiter l'expertise et la puissance de l'ensemble de la communauté de recherche sur la levure de manière coordonnée représenterait l'approche ultime au niveau des systèmes, la version biologique de la science sophistiquée du CERN.

Le domaine de la biologie des systèmes de levure a parcouru un long chemin ( Botstein et Fink 2011), mais le moment est peut-être venu pour nous de faire le prochain grand pas. La communauté de la levure devrait être en mesure de fournir le type de données dont les biologistes et les théoriciens ont besoin pour réaliser la modélisation d'une cellule eucaryote.


RÉSULTATS

F1-L'activité ATPase est compromise dans yme1 cellules: yme1 la levure croît très lentement en l'absence d'ADNmt. Ce phénotype est facilement noté en cultivant des cellules en présence de bromure d'éthidium, ce qui provoque la perte quantitative d'ADNmt des cellules (S lonimski et al. 1968 Renard et al. 1991). Nous avons identifié des mutations dominantes dans deux F1 sous-unités, ATP1-75 et ATP3-1, qui suppriment ce phénotype petite-négatif de yme1 souches (Figure 1 W eber et al. 1995 Kominsky et T horsness 2000). À la lumière de cette observation, nous avons examiné F1F0-Activité ATPase dans les mitochondries isolées de type sauvage, yme1, et yme1 souches portant des suppresseurs du phénotype petite-négatif. Les mitochondries de souches contenant un génome mitochondrial intact (ρ + ) et de souches dépourvues d'ADNmt (ρ°) ont été dosées en présence et en absence d'oligomycine, un inhibiteur de la F couplée.1F0-Activité ATPase. Comme le montre la figure 2A, l'activité ATPase mitochondriale dans yme1 Les cellules ρ+ sont 15 % inférieures à celles du type sauvage. En revanche, la suppression yme1 ATP1-75 et yme1 ATP3-1 les souches ont affiché une augmentation marquée du niveau d'activité ATPase mitochondriale, ∼20% plus élevé que celui du type sauvage. De plus, l'activité ATPase mitochondriale totale dans les souches supprimées était moins sensible à l'oligomycine. L'activité ATPase non couplée, F1-ATPase, était deux fois plus élevée dans yme1 souches de levure portant la ATP1-75 ou ATP3-1 mutations que dans les non supprimées yme1 souche.

— Suppression de la yme1 phénotype petite-négatif. Les souches indiquées ont été étalées sur une plaque de glucose synthétique dépourvue de (A) ou contenant (B) 25 ug/ml de bromure d'éthidium et ont été incubées pendant 5 jours à 30°. La croissance de levure en présence de bromure d'éthidium induit la perte quantitative d'ADNmt (S lonimski et al. 1968 Renard et al. 1991). Les souches étaient les suivantes : yme1, PTY52 ATP1-75 ans1, PTY93 ATP3-1 yme1, PTY109 atp4, DKY40 atp7, DKY44 atp4?? yme1, DKY48 atp7?? yme1, DKY50 et de type sauvage, PTY44.

—Activité ATPase dans yme1 Levure. Cinq microgrammes de mitochondries + (A) ou ° (B) isolées des souches indiquées ont été dosés en triple. Les données sont des moyennes +/- erreur standard de la moyenne. Les réactions ont été incubées sans (-) ou avec (+) oligomycine (2 µg/ml) pour déterminer la fraction d'activité ATPase inhibée. L'activité spécifique de l'ATPase est exprimée en [micromoles de Pje par minute par microgramme de protéine (×1000)]. Les souches étaient les suivantes : yme1, PTY52 yme1 ATP3-1, PTY109 yme1 ATP1-75, PTY93 et ​​de type sauvage, PTY44.

Parce que yme1 Les levures ρ° ne poussent pas assez bien pour permettre l'accumulation de cellules ° pour l'analyse biochimique, nous avons mis au point un schéma pour induire rapidement la perte d'ADNmt des cultures + de levures par ajout de 25 g/ml de bromure d'éthidium ( matériels et méthodes ) . Ce traitement a généré >90% de petites cytoplasmes sans accumulation significative de suppresseurs extragéniques. Nous avons dosé l'activité ATPase mitochondriale et F insensible à l'oligomycine1-Activité ATPase de type sauvage, yme1, et supprimé yme1 petites souches cytoplasmiques préparées de cette manière (figure 2B). Pour toutes les souches, l'activité ATPase mitochondriale totale des cellules ° était essentiellement inchangée par rapport à celle des cellules ρ+ correspondantes. La proportion de F insensible à l'oligomycine1L'activité -ATPase, cependant, était significativement différente dans les cellules ρ+ et ρ°. Typiquement, dans une population cellulaire homogène °, l'activité ATPase mitochondriale est découplée et donc insensible à l'oligomycine en raison de l'absence d'un F complet0 complexe. Ceci est largement observé dans les cellules ρ° de type sauvage préparées à partir d'un traitement batch au bromure d'éthidium, dans lesquelles 66% de l'activité ATPase est insensible à l'oligomycine, contre 15% dans les cellules ρ+. L'activité ATPase sensible à l'oligomycine restante dans les cellules de type sauvage ρ° reflète probablement une production incomplète de cellules ρ° (jusqu'à 10 % des cellules étaient ρ + dans les cultures traitées au bromure d'éthidium) et la présence de protéines résiduelles codées dans les mitochondries maintenu pendant la croissance des cultures traitées au bromure d'éthidium. Contrairement au type sauvage, seulement 40 % de l'activité ATPase dans yme1 ρ° les mitochondries sont insensibles à l'oligomycine. Cela suggère qu'une proportion importante de la F1 complexe est toujours couplé à F0 sous-unités dans yme1 Levure. Activités de l'ATPase mitochondriale dans yme1 ρ° cellules portant des mutations suppressives dans ATP1 et ATP3 sont, comme dans les souches ρ +, significativement plus élevées que celles de type sauvage ou yme1 Levure. La majorité de l'activité ATPase dans ces yme1 souches est insensible à l'oligomycine F1-Activité ATPase, comme c'était le cas pour le type sauvage.

—Quantification d'Atp1p et d'Atp2p dans le type sauvage et yme1 Levure. (A) Immunodétection des protéines mitochondriales. Environ 15 ug de mitochondries des souches indiquées ont été résolus sur un gel de polyacrylamide dénaturant à 7,5%. Les protéines ont été transférées sur nitrocellulose et sondées avec des anticorps contre les sous-unités α et de F1F0-ATPase (Atp1p et Atp2p, respectivement) et Arg8p, une protéine présente dans la matrice mitochondriale. (B) Concentration relative d'Atp1p et d'Atp2p dans le type sauvage et yme1 Levure. Le transfert dans A a été numérisé et les signaux relatifs quantifiés en utilisant le logiciel Molecular Analyst de Bio-Rad. Pour contrôler les différences de concentration de l'échantillon, la quantité relative d'Atp1p et d'Atp2p dans chaque voie a été normalisée à la quantité d'Arg8p. Les concentrations de type sauvage d'Arg8p, Atp1p et Atp2p ont été fixées à 100. Souches : type sauvage, PTY44 yme1, PTY52 yme1 ATP1-75, PTY93 et yme1 ATP3-1, PTY109.

Le F diminué1F0-Activité ATPase de yme1 levure peut être le résultat d'une diminution des niveaux de la F1F0-Complexe ATPase, augmentation de l'inhibition de la F1F0-ATPase, ou une combinaison des deux. De même, l'augmentation de F1F0-Activité ATPase des souches supprimées (yme1 ATP1-75 et yme1 ATP3-1) peut être le résultat de modifications de la structure protéique qui augmentent l'activité, une augmentation de l'accumulation de F1F0-protéine ATPase, ou une combinaison des deux. Par conséquent, le montant de F1F0-Les sous-unités ATPase α (Atp1p) et β (Atp2p) ont été déterminées par immunodétection d'extraits de protéines mitochondriales liés à la nitrocellulose (Figure 3). Pour comparer la concentration d'Atp1p et d'Atp2p trouvée dans chaque souche, la concentration relative d'une protéine mitochondriale indépendante, Arg8p, a été déterminée et utilisée pour corriger les différences de concentration de l'échantillon (figure 3B). Dans ρ + cellules, yme1 les cellules de levure n'ont qu'une légère réduction de la quantité d'Atp1p et d'Atp2, indiquant que la base de la diminution de l'activité ATPase dans yme1 mitochondries est due à l'inhibition de l'activité enzymatique. En revanche, il y avait une diminution de six fois de la quantité d'Atp1p et d'Atp2p dans yme1?? ATP1-75 levure bien que ces cellules aient 20 % plus de F1F0-Activité ATPase que le type sauvage avait (figure 2A). Par conséquent, le chiffre d'affaires de F1F0-ATPase par rapport à l'hydrolyse de l'ATP dans le yme1?? ATP1-75 la souche a été augmentée >16 fois. De même, le yme1?? ATP3-1 souche a présenté une diminution modeste de la concentration relative d'Atp1p et, par conséquent, une augmentation modeste du nombre de renouvellement d'ATPase, environ trois fois supérieur à celui de la souche F de type sauvage.1F0-ATPase.

—Accumulation de F0 sous-unités dans yme1 Levure. Quinze microgrammes de mitochondries provenant des souches indiquées ont été résolus sur un gel de polyacrylamide à 12 % dénaturant. Les protéines ont été transférées sur nitrocellulose et sondées avec des anticorps contre Atp4p (anti-su 4) et Atp7p (anti-su 7). (A) + mitochondries. (B) ρ° mitochondries. Souches : poids, PTY44 yme1, PTY52 yme1 ATP3-1, PTY109 et yme1 ATP1-75, PTY93.

F0 les sous-unités s'accumulent dans yme1 ° cellules: Des travaux antérieurs ont démontré qu'aucun des F1 sous-unités, Atp3p et Atp1p, est retournée d'une manière dépendante de Yme1p (W eber et al. 1995). De plus, la présence d'une proportion supérieure à la normale d'activité ATPase sensible à l'oligomycine dans yme1 ρ° levure a suggéré que le F1 complexe dans ces mitochondries pourrait encore interagir avec F0 sous-unités. Par conséquent, nous avons examiné le sort de F0 sous-unités dans yme1 cellules. Des expériences d'immunodétection ont été réalisées à l'aide d'anticorps polyclonaux dirigés contre Atp4p et Atp7p, deux sous-unités de la F0 complexe. Comme le montre la figure 4A, il n'y a pas de différence dans les concentrations de ces protéines dans les mitochondries + isolées de type sauvage, yme1, ou supprimé yme1 Levure. Cependant, Atp4p et Atp7p s'accumulent dans yme1 ρ° levure ainsi que dans le yme1 ATP1-75 et yme1 ATP3-1 mutants (figure 4B). D'autres chercheurs ont noté le chiffre d'affaires dépendant de Yme1p de F0 sous-unités 4, 5, 6 et 17 dans oxa1Δ souches de levure (L emaire et al. 2000).

—Génération d'un potentiel de membrane mitochondriale interne par addition de succinate dans la levure +. Les mitochondries ρ + ont été isolées de type sauvage, yme1, et supprimé yme1 ATP3-1 et yme1 ATP1-75 Levure. L'absorption dépendante potentielle de l'iodure de 3,3'-dipropylthiocarbocyanine est exprimée en pourcentage de fluorescence relative. Le moment de l'ajout du tris-succinate est indiqué par S, et le moment de l'ajout du découpleur cyanure de carbonyle m-chlorophénylhydrazone est indiqué par C. Souches : sauvage ρ + , PTY44 yme1 + , PTY52 yme1 ATP3-1 + , PTY109 et yme1 ATP1-75 + , PTY93.

To determine whether the accumulation of Atp4p or Atp7p was the basis for the abnormally high proportion of oligomycin-sensitive ATPase activity of yme1 ρ° yeast, we tested whether a null mutation in ATP4 et/ou ATP7 suppressed the yme1 petite-negative phenotype. Neither the atp4?? yme1 et le atp7?? yme1 double mutants (Figure 1) nor the atp4?? atp7?? yme1 triple mutant (data not shown) grew in the absence of mtDNA thus these mutations did not suppress the yme1 ρ° lethality. Les atp4et atp7Δ mutants alone displayed no phenotype in the absence of mtDNA. It is possible that other F0 subunits may be involved in yme1 ρ° lethality, as four additional F0 subunits are encoded in the nucleus. Alternatively, accumulation of F0 subunits in yme1 yeast may be a separate phenomenon from that of the petite-negative phenotype of these cells.

The inner mitochondrial membrane potential is diminished in yme1 yeast: Inactivation of ATP synthase F1 subunits coupled with the loss of mtDNA results in a decrease of the inner mitochondrial membrane potential (G iraud and V elours 1997). Because the petite-negative phenotype of yme1 yeast can be rescued by mutations in two F1 proteins, we examined the membrane potential in yme1 cellules. Changes in the membrane potential of mitochondria isolated from ρ + yeast in response to the addition of succinate were monitored by measuring the uptake of the fluorescent dye 3,3′-dipropylthiocarbocyanine iodide. These changes were recorded after the addition of a substrate, tris-succinate, and after the addition of an uncoupler, carbonyl cyanide m-chlorophenylhydrazone. Mitochondria prepared from the yme1 ρ + , yme1 ATP3-1 ρ + , and yme1 ATP1-75 ρ + mutant strains all exhibit a reduction of membrane potential relative to wild type as judged by the relative change in fluorescence upon addition of the uncoupler (Figure 5).

The ability to generate a membrane potential in response to succinate is dependent upon electron transport, a feature absent in ρ° cells. Instead, the generation of membrane potential in ρ° mitochondria is created by the flux of ATP and ADP through the ATP/ADP translocator (G iraud and V elours 1997). Consequently, we examined the ability of wild-type and mutant yeast strains to generate a membrane potential using ATP by monitoring fluorescence of rhodamine 123 (Figure 6). Wild-type ρ + and ρ° mitochondria generated a membrane potential in response to added ATP, as indicated by the decrease in relative fluorescence (Figure 6A). The membrane potential was destroyed by the addition of the ionophore valinomycin, and the magnitude of the membrane potential can be judged by the relative change in fluorescence that occurred in response to addition of valinomycin. The greater membrane potential in ρ + as compared to that of ρ° mitochondria is probably a reflection of both the flux of ATP/ADP through the translocator and the ability to pump protons out of mitochondria upon ATP hydrolysis by the F1F0-ATPase. Étonnamment, yme1 mitochondria, whether ρ + or ρ°, did not generate a membrane potential in response to the addition of ATP, and the small potential present before the addition of ATP was actually destroyed (Figure 6B) by the addition of ATP. Mitochondria prepared from ρ + and ρ° yme1 strains bearing a suppressing mutation in the α-subunit of ATP synthase (yme1 ATP1-75 strains) once again generated a membrane potential in response to ATP (Figure 6C). The ρ° mitochondria from wild-type or yme1 ATP1-75 yeast, whether prepared from clonal ρ° cultures (Figure 6C) or from ρ + strains treated with ethidium bromide (data not shown), generated a membrane potential in response to ATP. Hence, the petite-negative phenotype of yme1 yeast is likely due to the inability of the mitochondria to generate a membrane potential in response to ATP.

—Generation of an inner mitochondrial membrane potential in ρ + and ρ° yeast by addition of ATP. Mitochondria were isolated from wild-type, yme1, et yme1 ATP-75 Levure. The ρ° mitochondria prepared from wild-type and yme1 ATP1-75 strains are quantitatively ρ°. The ρ° mitochondria prepared from the yme1 strain were generated from a batch culture of ρ + cells by treatment with ethidium bromide. The potential dependent quenching of rhodamine 123 fluorescence is expressed as percentage of relative fluorescence. ATP was added at ∼240 sec, and the ionophore valinomycin was added at ∼420 sec. Strains: wild-type ρ + , PTY44 wild-type ρ°, PTY44ρ° yme1 ρ + , PTY52 yme1 ρ°, PTY52ρ° yme1 ATP1-75 ρ + , PTY93 and yme1 ATP1-75 ρ°, PTY93ρ°.

Suppression de INH1 partially suppresses the petite-negative phenotype of yme1 ρ° cells: Mitochondrial ATPase activity in ρ° cells is necessary for the generation of a membrane potential in mitochondria (G iraud and V elours 1997). Since a yme1 strain has low ATPase activity compared to that of wild-type strains and since suppressing mutations of the α- and γ-subunits of F1-ATPase subunits lead to an increase in ATPase activity, it is possible that an inhibitor of F1-ATPase accumulates in yme1 souches. The accumulation of an F1-ATPase inhibitor might contribute to the ρ° slow-growth phenotype of the yme1 mutant. Several small peptides encoded in the nucleus of yeast inhibit F1-ATPase activity. INH1 encodes an intrinsic F1F0-ATPase inhibitor (I chikawa et al. 1990 Y oshida et al. 1990). Inactivation of INH1 shows no phenotype in otherwise wild-type yeast and has been proposed to inhibit the F1F0-ATPase when the F1 et F0 portions of the ATPase are uncoupled. Inactivation of INH1 dans un yme1 background partially complemented the ρ° slow-growth phenotype (Figure 7). Two other nuclear genes, TIM11 et STF1, also affect F1F0-ATPase activity. TIM11 encodes a protein necessary for the assembly of F1F0-ATPase into dimers (A rnold et al. 1998), and STF1 encodes a protein with sequence similarity to INH1 (A kashi et al. 1988). When we tested whether a TIM11 deletion (Figure 7) or a STF1 deletion (data not shown) rescued the yme1 ρ° slow-growth phenotype, neither of these mutations, singly or in combination with each other or with inh1Δ, complemented the yme1 ρ° slow-growth phenotype (Figure 7 and data not shown). Suppression de INH1, TIM11, ou STF1 did not create a slow-growth phenotype in otherwise wild-type ρ° strains (Figure 7 and data not shown).

—Inactivation of an endogenous F1F0-ATPase inhibitor partially suppresses the yme1 ρ° slow-growth phenotype. The indicated yeast strains were cultured on (A) synthetic glucose media (SD) or (B) synthetic glucose media that contained 25 μg/ml ethidium bromide (SD + EtBr) for 5 days at 30°, creating ρ° strains. Strains: wild type, PTY44 inh1Δ, PTY190 tim11Δ, PTY191 inh1?? tim11Δ, PTY192 yme1Δ, PTY52 yme1?? inh1Δ, PTY193 yme1?? tim11Δ, PTY194 and yme1?? inh1?? tim11Δ, PTY195.


Introduction

While direct investigation of human biology can often be limited due to practical or ethical considerations, the wide array of model organisms available to researchers has allowed a remarkable amount of discovery into our own molecular functioning. All living organisms share commonalities in their underlying molecular makeup thus, knowledge of processes studied in one organism can often be translated to others. Eukaryotic microorganisms, with replication times and tractability akin to bacteria, but much more overlap in cellular components to humans, have proven especially useful in studying human biology. Chief among these, the budding yeast Saccharomyces cerevisiae has been an invaluable tool for uncovering much of the basic biology that underlies human cell functioning and disease.

The last common ancestor of humans and yeast is estimated to have lived approximately a billion years ago [ 1], and we still share a substantial portion of our genetic material. The human genome contains roughly 20 000 protein-coding genes while the yeast genome comprises about 6000. A pairwise comparison of genes between the species reveals ∼2100 groups of orthologs, representing 2300 yeast genes and 3900 human genes [ 2] ( Figure 1). Many shared genes perform important cellular roles in both organisms, and their perturbation leads to diverse human disorders, from cancer to Mendelian diseases. The homology between humans and yeast, and the inherent tractability of yeast, has enabled researchers to expand its usefulness as a model for human biology, both by heterologous expression of human proteins, as well as by directly modifying yeast cells to humanize specific amino acids, proteins or even entire yeast pathways ( Figure 2).

Humans and yeast share thousands of orthologous genes. The Venn diagram illustrates counts of human–yeast orthologs [ 2], grouped according to the nature of the orthology (classifying orthologs according to whether their count in humans:yeast is 1:1, many:1, or many:many) and whether the yeast genes are essential or not under standard laboratory growth conditions [ 3]. (A colour version of this figure is available online at: http://bfg.oxfordjournals.org)

Humans and yeast share thousands of orthologous genes. The Venn diagram illustrates counts of human–yeast orthologs [ 2], grouped according to the nature of the orthology (classifying orthologs according to whether their count in humans:yeast is 1:1, many:1, or many:many) and whether the yeast genes are essential or not under standard laboratory growth conditions [ 3]. (A colour version of this figure is available online at: http://bfg.oxfordjournals.org)

Five degrees of yeast humanization. Yeast have proven useful for the direct study of human biology in a variety of forms, illustrated here to distinguish those cases in which yeast were simply studied for human-specific processes and drugs (degree 0), to the heterologous expression of human genes in yeast (degree 1), all the way to the directed replacement of specific amino acids, genes, and pathways (degrees 2–4, respectively). (A colour version of this figure is available online at: http://bfg.oxfordjournals.org)

Five degrees of yeast humanization. Yeast have proven useful for the direct study of human biology in a variety of forms, illustrated here to distinguish those cases in which yeast were simply studied for human-specific processes and drugs (degree 0), to the heterologous expression of human genes in yeast (degree 1), all the way to the directed replacement of specific amino acids, genes, and pathways (degrees 2–4, respectively). (A colour version of this figure is available online at: http://bfg.oxfordjournals.org)

Two early successes in humanization were demonstrated in 1985 and 1987 as a means of identifying human genes capable of rescuing yeast mutants: First, Kataoka et al. [ 4] expressed chimeric yeast/human or full human RAS genes in yeast Δras mutants to demonstrate the functional homology retained between the two species. Next, in a famous and elegant experiment to identify human genes possessing the same function as fungal CDC2, Lee and Nurse [ 5] expressed a large library of human cDNAs in fission yeast (Schizosaccharomyces pombe), to identify an orthologous protein capable of rescuing a S. pombe Δcdc2 mutant.

In the 30 years since these experiments, more than 400 yeast genes have been humanized [ 6–8]. Studies have ranged in their degree of direct translation to humans, from using yeast proteins to identify targets for human drugs to large-scale replacement of yeast genes with their human orthologs [ 9]. In this review, we discuss these ongoing efforts to develop and utilize humanized yeast, and their increased emphasis on high-throughput construction and applications. We consider five ‘degrees' of humanization, representing increasing levels by which the yeast have been altered to resemble the human case ( Figure 2).


Matériaux et méthodes

Strains and media

Yeast strains 779-6A (TAPISune, kar1-1, SUQ5, ade2-1, his3??202, leu2??1, trp1??63, ura3-52) (Jung and Masison, 2001 ) and W303 (TAPISune, ade2-1, ura3-1, his3-11, trp1-1, leu2-3, leu2-112, can1-100, GAL, SUC) (ATCC 208 352) were used. The 779-6A strain used throughout this study is [psi + ], since it contained the prion form of the Sup35 protein. The W303 strain is used commonly in yeast research. HSP104 was deleted in strain 779-6A by transformation, using a PCR-amplified KanMX disruption cassette from a yeast deletion strain (ATCC) (Jones et al., 2004 ). Yeast were grown at 30 °C in SD (synthetic defined Sunrise Science Products) medium containing 2% glucose, 7 g/l yeast nitrogen base (YNB Sunrise Science Products) and the appropriate complete supplement mixture (CSM) to maintain plasmid(s) selection. YPD medium contains 1% yeast extract, 2% peptone and 2% dextrose. 1/2YPD is similar to YPD but contains 0.5% yeast extract. The galactose medium contains 2% galactose and 2% raffinose in place of glucose. Cultures were maintained in log phase (OD600 < 0.6) by periodic dilution with fresh medium. E. coli strain DH5α was used for plasmid propagation.

Plasmid constructions

HSP104 (position − 844 to + 2965) flanked by FRT sites was amplified from genomic DNA of S. cerevisiae strain 779-6A with the primer pair HSP104-1 (5′-ta ggatcc gaagttcctattctctagaaagtataggaacttcgactg ctcttgcacagaacctccc-3′) and HSP104-2 (5′-ta ctcgag gaagttcctatactttctagagaataggaacttcctttagttatcaacgcc atatgtccc-3′). The PCR product was digested with BamBonjour et XhoI and cloned in pRS314 to generate pC4F-HSP104. To construct pC4FURA3, KpnJE-Sacje URA3 (from − 225 to + 63) fragment flanked by 34 bp FRT was amplified by PCR from the plasmid pRS316 with the primer pair URA3–7 (5′-at gagctc gaagttcctattctctagaaagtataggaacttc gggccc ttttc aattcaattcatcatttttttt-3′) and URA3-8 (5′-at ggtacc ga agttcctatactttctagagaataggaacttc cggccg taataactgatat aattaaattga-3′), digested with KpnJE-SacI and inserted into the plasmid pRS314. Les ApaJE-Pasje URA3 fragment in plasmid pC4FURA3 was replaced with ApaJE-EagI-digested m ulti- c loning s ite (MCS) from the plasmid pRS314 and this resulted in pC4FMCS. Plasmid pC4FGFP was constructed by inserting ApaJE-PasI fragment from pJ543 containing the ORF of GFP, which is under the control of SUP35 promoter (from − 600 to − 2), and fused to SUP35 terminator (182 bp of 3′ UTR), into the ApaJE-EagI-digested pC4FMCS. L'ORF de FLP was amplified from plasmid pTET23 (Park and Morschhauser, 2005 ) by using the primer pair FLP2 (tata ggatcc atgtcacaatttgatatattatgtaaaacacc) and FLP3 (tata cccggg ttatatgcgtctatttatgtaggatgaaag g), then inserted into XhoJE-BamHI-digested GAL1 promoter fragment and NoëlJE-SacI terminator fragment of HSP104 dans XhoJE-SacI-digested pRS315 to create pC5GAL1–FLP. Underlined sequences in the primers indicate the inserted restriction sites. All sequences have been verified. All the backbone plasmids have been described in detail (Sikorski and Hieter, 1989 ).

Determination of pre-excision rate under non-inducing conditions

To determine the [psi + ]/[psi − ] phenotype, cells of the Δhsp104 [psi + ] strain having plasmids pC4F-HSP104 and pC5GAL1–FLP were grown in SD—Trp—Leu drop-out medium to mid-log phase and then plated onto SD—Trp—Leu drop-out agar plate containing 10 µg/ml adenine. After 5 days of incubation at room temperature, the percentage of [psi − ] red colonies, which represents the pre-excision rate of HSP104, was determined. The determined data include some ‘spontaneous’ prion loss, whose frequency, determined by the strain having only pC4F-HSP104, was < 0.2%, could be due to increased Hsp104 in cells that have more than one copy of the plasmid.

Measurement of URA3 gene-flipping efficiency

Cells of strain 779-6A or W303 having plasmids pC4FURA3 and pC5GAL1–FLP grown in SD—Trp—Leu—Ura drop-out medium were transferred into similar SD-Trp-Leu medium with galactose in place of dextrose to induce Flp recombinase. During growth in galactose medium, aliquots of cells at the indicated generations (see Results), as determined by doubling of OD600, were plated onto both YPD and uracil drop-out agar plates. To calculate the number of cells per 1 ml culture, cells in the aliquot were counted using a cell-counting chamber (Neubauer, 0.0025 mm 2 ). After 3 days of incubation at 30 °C, the colonies were counted and the excision rate was calculated as colony number on uracil drop-out agar plates vs colony number on YPD plates, or the counted cell number.

Imagerie

The GFP fluorescence in yeast was imaged using the Zeiss LSM510 confocal microscope with a × 63 objective. The same settings were used for imaging the GFP fluorescence in the different strains throughout the experiment.


Synopsis

A major goal of systems biology is to uncover the underlying structure of biological networks in order to develop comprehensive models of biological processes that are both accurate and predictive. In addition to genes that perform a single function, genetic networks also contain genes that perform many functions. To date, the network architecture of these multi-function or pleiotropic genes has not been well characterized. This study uses a combination of functional genomics and computational methods to reveal a non-trivial organization of highly pleiotropic genes in the important model organism S. cerevisiae.

Pleiotropy is a relatively common, but poorly understood phenomenon in biology defined as the ability of a mutation in a single gene to produce multiple effects in vivo. The prevalence of pleiotropy is perhaps most striking in the growing number of human diseases for which a mutation in a single gene produces a broad and seemingly unrelated set of symptoms ( Brunner and van Driel, 2004 ). In yeast, the availability of resources such as a complete set of isogenic deletion mutants ( Giaever et al., 2002 ) makes it possible to identify a comprehensive set of genes required for growth under a given environmental condition. To facilitate such genome-wide mutant analysis under a large number of conditions, we developed a cost-effective strategy to measure the growth of individual strains on standard agar plates. We used this method to assay the complete set of non-essential yeast gene deletions (4,700 mutants) under 21 environmental conditions in duplicate (>10 5 data points) and identified 216 highly pleiotropic mutants with growth defects in 3 or more conditions.Figure 6

It has long been hypothesized that pleiotropy, while frequently observed, poses significant disadvantages for the evolvability of an organism, including limiting the rate of adaptation and reducing the level of adaptation for some traits in response to selection for others ( Otto, 2004 ). By generating phenotype data for a relatively large number of conditions we were able to make an initial estimate of the overall degree of pleiotropy in yeast. We assessed the level of pleiotropy in our data by counting the number of phenotypes observed for each mutant. The results (Figure 8) show that approximately 70% of the mutants have a relatively low degree of pleiotropy, with phenotypes in only one or two conditions, and the remaining 30% are highly pleiotropic, with growth defects in as many as 14 conditions. To test the statistical significance of this amount of pleiotropy, we compared our data to a randomly generated distribution of phenotypes per mutant (Figure 8). A statistical comparison of these distributions demonstrates that the degree of pleiotropy we observe in an important model organism, Saccharomyces cerevisiae, is significantly greater than can be explained by chance. These results, support the hypothesis that pleiotropy plays an important role in biological systems.

Our work also yields a number of widely applicable technical advances that have the potential to meet one of the greatest challenges in understanding pleiotropic genes—determining whether the phenotypes associated with a mutation are the result of the loss of a single function or of multiple functions encoded by the same gene. In human disease research, understanding gene function at this level provides important information relevant for devising effective treatments and analyzing drug side-effects. Unfortunately, classical approaches for dissecting the behavior of pleiotropic genes, such as searching for multiple alleles of a gene that exhibit different phenotypes, are time-consuming and often not feasible in a clinical setting. To address this problem, we developed a method for determining the association between gene functions and mutant phenotypes based on a single mutant allele, such as a complete gene deletion.

The strong link between mutant phenotype and cellular function suggests that high throughput methods for measuring phenotypes may be used to identify such functions de novo. In our study, we identified groups of mutants that shared a statistically significant set of phenotypes. The high degree of overlap between these clusters and known biological process annotations, synthetic lethal interactions, and protein complexes supported the hypothesis that this high throughput, unsupervised method can be used to discover genetically defined functional categories. Application of these functional predictions to the phenotype profiles of the highly pleiotropic mutants allowed us to generate hypotheses about the number of functions carried out by these genes and the conditions under which they are required (Figure 6). While extremely powerful in yeast, these methods hold even greater promise for analysis in organisms that are less genetically tractable, such as mammalian cell lines in which endogenous genes can be silenced using RNAi technology ( Schutze, 2004 ).


Contenu

S. cerevisiae (levure) peut exister de manière stable en tant que diploïde ou haploïde. Les cellules de levure haploïdes et diploïdes se reproduisent par mitose, les cellules filles bourgeonnant à partir des cellules mères. Les cellules haploïdes sont capables de s'accoupler avec d'autres cellules haploïdes du type d'accouplement opposé (un une ne peut s'accoupler qu'avec une cellule α, et vice versa) pour produire une cellule diploïde stable. Les cellules diploïdes, généralement confrontées à des conditions stressantes telles que l'épuisement des nutriments, peuvent subir une méiose pour produire quatre spores haploïdes : deux spores a et deux spores .

Différences entre les cellules a et Modifier

une les cellules produisent 'une-factor', une phéromone d'accouplement qui signale la présence d'un une cellule aux cellules α voisines. une les cellules répondent au facteur , la phéromone d'accouplement des cellules α, en faisant croître une projection (appelée shmoo, en raison de sa forme distinctive ressemblant au personnage de dessin animé d'Al Capp Shmoo) vers la source du facteur . De même, les cellules α produisent le facteur et répondent à une-facteur en faisant croître une projection vers la source de la phéromone. La réponse des cellules haploïdes uniquement aux phéromones d'accouplement du type d'accouplement opposé permet l'accouplement entre une et les cellules α, mais pas entre les cellules du même type d'accouplement.

Ces différences phénotypiques entre une et les cellules α sont dues à un ensemble différent de gènes activement transcrits et réprimés dans les cellules des deux types d'accouplement. une les cellules activent les gènes qui produisent une-facteur et produisent un récepteur de surface cellulaire (Ste2) qui se lie au facteur et déclenche la signalisation dans la cellule. une les cellules répriment également les gènes associés au fait d'être une cellule . De même, les cellules α activent les gènes qui produisent le facteur α et produisent un récepteur de surface cellulaire (Ste3) qui se lie et répond à une-facteur, et les cellules α répriment les gènes associés au fait d'être un une cellule.

Les TAPIS lieu Modifier

Les différents ensembles de répression et d'activation transcriptionnelles qui caractérisent une et les cellules α sont causées par la présence de l'un des deux allèles d'un locus appelé TAPIS: TAPISune ou MATα situé sur le chromosome III. Le locus MAT est généralement divisé en cinq régions (W, X, Y, Z1 et Z2) en fonction des séquences partagées entre les deux types d'accouplement. La différence réside dans la région Y (Yune et Yα), qui contient la plupart des gènes et des promoteurs.

Les TAPISune allele of TAPIS code un gène appelé une1, qui, chez les haploïdes, dirigent la transcription de la une-programme transcriptionnel spécifique (tel que l'expression STE2 et réprimant STE3) qui définit un une cellule. Les MATα allele of TAPIS code pour les gènes 1 et α2, qui, chez les haploïdes, dirigent la transcription du programme transcriptionnel -spécifique (tel que l'expression STE3, réprimant STE2) ce qui fait que la cellule est une cellule . [2] S. cerevisiae has an une2 gène sans fonction apparente qui partage une grande partie de sa séquence avec α2 cependant, d'autres levures comme Candida albicans avoir un MAT fonctionnel et distinctune2 gène. [3] [4]

Différences entre les cellules haploïdes et diploïdes Modifier

Les cellules haploïdes sont l'un des deux types d'accouplement (une ou α), et répondent à la phéromone d'accouplement produite par les cellules haploïdes du type d'accouplement opposé, et peuvent s'accoupler avec des cellules du type d'accouplement opposé. Les cellules haploïdes ne peuvent pas subir de méiose. Les cellules diploïdes ne produisent ni ne répondent à l'une ou l'autre des phéromones d'accouplement et ne s'accouplent pas, mais peuvent subir une méiose pour produire quatre cellules haploïdes.

Comme les différences entre haploïde une et les cellules α, différents modèles de répression et d'activation des gènes sont responsables des différences phénotypiques entre les cellules haploïdes et diploïdes. En plus des spécificités une et α modèles transcriptionnels, les cellules haploïdes des deux types d'accouplement partagent un modèle transcriptionnel haploïde qui active les gènes haploïdes spécifiques (tels que HO) et réprime les gènes spécifiques aux diploïdes (tels que IME1). De même, les cellules diploïdes activent les gènes spécifiques aux diploïdes et répriment les gènes spécifiques aux haploïdes.

Les différents modèles d'expression des gènes des haploïdes et des diploïdes sont à nouveau dus à la TAPIS lieu. Les cellules haploïdes ne contiennent qu'une copie de chacun des 16 chromosomes et ne peuvent donc posséder qu'un seul allèle de TAPIS (Soit TAPISune ou MATα), qui détermine leur type d'accouplement. Les cellules diploïdes résultent de l'accouplement d'un une cellule et une cellule α, et possèdent ainsi 32 chromosomes (en 16 paires), dont un chromosome portant le TAPISune allèle et un autre chromosome portant le MATα allèle. La combinaison des informations codées par le TAPISune allèle (le une1 gène) et le MATα allèle (les gènes α1 et α2) déclenche le programme transcriptionnel diploïde. De même, la présence d'un seul allèle de TAPIS, quoi que ce soit TAPISune ou MATα, déclenche le programme transcriptionnel haploïde.

Les allèles présents au TAPIS locus sont suffisants pour programmer le comportement d'accouplement de la cellule. Par exemple, en utilisant des manipulations génétiques, un TAPISune allèle peut être ajouté à un MATα cellule haploïde. Malgré un complément haploïde de chromosomes, la cellule possède désormais à la fois TAPISune et MATα allèles, et se comportera comme une cellule diploïde : elle ne produira pas ou ne répondra pas aux phéromones d'accouplement, et lorsqu'elle est affamée, elle tentera de subir une méiose, avec des résultats fatals. De même, la suppression d'un exemplaire du TAPIS locus dans une cellule diploïde, ne laissant qu'un seul TAPISune ou MATα allèle, fera qu'une cellule avec un complément diploïde de chromosomes se comportera comme une cellule haploïde.

L'accouplement chez la levure est stimulé par la présence d'une phéromone qui se lie soit au récepteur Ste2 (dans les cellules a) soit au récepteur Ste3 (dans les cellules ). La liaison de cette phéromone conduit alors à l'activation d'une protéine G hétérotrimérique. The dimeric portion of this G-protein recruits Ste5 (and its related MAPK cascade components) to the membrane, and ultimately results in the phosphorylation of Fus3.

The switching mechanism arises as a result of competition between the Fus3 protein (a MAPK protein) and the phosphatase Ptc1. These proteins both attempt to control the 4 phosphorylation sites of Ste5, a scaffold protein with Fus3 attempting to phosphorylate the phosphosites, and Ptc1 attempting to dephosphorylate them.

Presence of α-factor induces recruitment of Ptc1 to Ste5 via a 4 amino acid motif located within the Ste5 phosphosites. Ptc1 then dephosphorylates Ste5, ultimately resulting in the dissociation of the Fus3-Ste5 complex. Fus3 dissociates in a switch-like manner, dependent on the phosphorylation state of the 4 phosphosites. All 4 phosphosites must be dephosphorylated in order for Fus3 to dissociate. Fus3's ability to compete with Ptc1 decreases as Ptc1 is recruited, and thus the rate of dephosphorylation increases with the presence of pheromone.

Kss1, a homologue of Fus3, does not affect shmooing, and does not contribute to the switch-like mating decision.

In yeast, mating as well as the production of shmoos occur via an all-or-none, switch-like mechanism. This switch-like mechanism allows yeast cells to avoid making an unwise commitment to a highly demanding procedure. However, not only does the mating decision need to be conservative (in order to avoid wasting energy), but it must also be fast to avoid losing the potential mate.

The decision to mate is extremely sensitive. There are 3 ways in which this ultrasensitivity is maintained:

  1. Multi-site phosphorylation – Fus3 only dissociates from Ste5 and becomes fully active when all 4 of the phosphosites are dephosphorylated. Even one phosphorylated site will result in immunity to α-factor.
  2. Two-stage binding – Fus3 and Ptc1 bind to separate docking sites on Ste5. Only after docking can they bind to, and act on, the phosphosites.
  3. Steric hindrance – competition between Fus3 and Ptc1 to control the 4 phosphosites on Ste3

[a and α yeast share the same mating response pathway, with the only difference being the type of receptor each mating type possesses. Thus the above description, given for a-type yeast stimulated with α-factor, works equally well for α-type yeast stimulated with a-factor.]

Wild type haploid yeast are capable of switching mating type between une and α. Consequently, even if a single haploid cell of a given mating type founds a colony of yeast, mating type switching will cause cells of both une and α mating types to be present in the population. Combined with the strong drive for haploid cells to mate with cells of the opposite mating type and form diploids, mating type switching and consequent mating will cause the majority of cells in a colony to be diploid, regardless of whether a haploid or diploid cell founded the colony. The vast majority of yeast strains studied in laboratories have been altered such that they cannot perform mating type switching (by deletion of the HO gene [5] see below) this allows the stable propagation of haploid yeast, as haploid cells of the une mating type will remain une cells (and α cells will remain α cells), and will not form diploids.

HML et HMR: the silent mating cassettes Edit

Haploid yeast switch mating type by replacing the information present at the TAPIS lieu. For example, an une cell will switch to an α cell by replacing the TAPISune allele with the MATα allèle. This replacement of one allele of TAPIS for the other is possible because yeast cells carry an additional silenced copy of both the TAPISune et MATα alleles: the HML (homothallic mating jeeft) locus typically carries a silenced copy of the MATα allèle, et le HMR (homothallic mating right) locus typically carries a silenced copy of the TAPISune allèle. The silent HML et HMR loci are often referred to as the silent mating cassettes, as the information present there is 'read into' the active TAPIS lieu.

These additional copies of the mating type information do not interfere with the function of whatever allele is present at the TAPIS locus because they are not expressed, so a haploid cell with the TAPISune allele present at the active TAPIS locus is still an une cell, despite also having a (silenced) copy of the MATα allele present at HML. Only the allele present at the active TAPIS locus is transcribed, and thus only the allele present at TAPIS will influence cell behaviour. Hidden mating type loci are epigenetically silenced by SIR proteins, which form a heterochromatin scaffold that prevents transcription from the silent mating cassettes.

Mechanics of the mating type switch Edit

The process of mating type switching is a gene conversion event initiated by the HO gène. Les HO gene is a tightly regulated haploid-specific gene that is only activated in haploid cells during the G1 phase of the cell cycle. The protein encoded by the HO gene is a DNA endonuclease, which physically cleaves DNA, but only at the TAPIS locus (due to the DNA sequence specificity of the HO endonuclease).

Once HO cuts the DNA at TAPIS, exonucleases are attracted to the cut DNA ends and begin to degrade the DNA on both sides of the cut site. This DNA degradation by exonucleases eliminates the DNA which encoded the TAPIS allele however, the resulting gap in the DNA is repaired by copying in the genetic information present at either HML ou HMR, filling in a new allele of either the TAPISune ou MATα gène. Thus, the silenced alleles of TAPISune et MATα present at HML et HMR serve as a source of genetic information to repair the HO-induced DNA damage at the active TAPIS lieu.

Directionality of the mating type switch Edit

The repair of the TAPIS locus after cutting by the HO endonuclease almost always results in a mating type switch. Quand un une cell cuts the TAPISune allele present at the TAPIS locus, the cut at TAPIS will almost always be repaired by copying the information present at HML. Cela se traduit par TAPIS being repaired to the MATα allele, switching the mating type of the cell from une to α. Similarly, an α cell which has its MATα allele cut by the HO endonuclease will almost always repair the damage using the information present at HMR, copying the TAPISune gene to the TAPIS locus and switching the mating type of α cell to une.

This is the result of the action of a recombination enhancer (RE) [6] located on the left arm of chromosome III. Deletion of this region causes une cells to incorrectly repair using HMR. Dans une cells, Mcm1 binds to the RE and promotes recombination of the HML region. In α cells, the α2 factor binds at the RE and establishes a repressive domain over RE such that recombination is unlikely to occur. An innate bias means that the default behaviour is repair from HMR. The exact mechanisms of these interactions are still under investigation.

Ruderfer et al. [7] analyzed the ancestry of natural S. cerevisiae strains and concluded that matings involving out-crossing occur only about once every 50,000 cell divisions. Thus it appears that, in nature, mating is most often between closely related yeast cells. Mating occurs when haploid cells of opposite mating type TAPISune et MATα come into contact. Ruderfer et al. [7] pointed out that such contacts are frequent between closely related yeast cells for two reasons. The first is that cells of opposite mating type are present together in the same ascus, the sac that contains the cells directly produced by a single meiosis, and these cells can mate with each other. The second reason is that haploid cells of one mating type, upon cell division, often produce cells of the opposite mating type with which they can mate (see section "Mating type switching", above). The relative rarity in nature of meiotic events that result from out-crossing appears to be inconsistent with the idea that production of genetic variation is the primary selective force maintaining mating capability in this organism. However this finding is consistent with the alternative idea that the primary selective force maintaining mating capability is enhanced recombinational repair of DNA damage during meiosis, [8] since this benefit is realized during each meiosis subsequent to a mating, whether or not out-crossing occurs.

Fission yeast Edit

Schizosaccharomyces pombe is a facultative sexual yeast that can undergo mating when nutrients are limiting. [9] Exposure of S. pombe to hydrogen peroxide, an agent that causes oxidative stress leading to oxidative DNA damage, strongly induces mating, meiosis, and formation of meiotic spores. [10] This finding suggests that meiosis, and particularly meiotic recombination, may be an adaptation for repairing DNA damage. [11] The overall structure of the TAPIS locus is similar to that in S. cerevisiae. The mating-type switching system is similar, but has evolved independently. [4]

Self-mating in Cryptococcus neoformans Éditer

Cryptococcus neoformans is a basidiomycetous fungus that grows as a budding yeast in culture and in an infected host. C. neoformans causes life-threatening meningoencephalitis in immune compromised patients. It undergoes a filamentous transition during the sexual cycle to produce spores, the suspected infectious agent. The vast majority of environmental and clinical isolates of C. neoformans are mating type α. Filaments ordinarily have haploid nuclei, but these can undergo a process of diploidization (perhaps by endoduplication or stimulated nuclear fusion) to form diploid cells termed blastospores. [12] The diploid nuclei of blastospores can then undergo meiosis, including recombination, to form haploid basidiospores that can then be dispersed. [12] This process is referred to as monokaryotic fruiting. Required for this process is a gene designated dmc1, a conserved homologue of genes RecA in bacteria, and RAD51 in eukaryotes. Dmc1 mediates homologous chromosome pairing during meiosis and repair of double-strand breaks in DNA (see Meiosis also Michod et al. [13] ). Lin et al. suggested that one benefit of meiosis in C. neoformans could be to promote DNA repair in a DNA damaging environment that could include the defensive responses of the infected host. [12]


Voir la vidéo: bioinformatique: Format des séquences biologiques + recherche sur la base NCBI (Juillet 2022).


Commentaires:

  1. Kajishakar

    Pas mal écrit, VRAIMENT....

  2. Ameretat

    Curieux. Je vais peut-être souscrire au RSS. :)

  3. Hansel

    Avez-vous le temps d'écrire un article sur une demi-page, mais pas de réponse? Amende

  4. Edlin

    Désolé, j'ai supprimé ce message

  5. Okhmhaka

    Il est compris de deux manières comme ça

  6. Killdaire

    Faire des erreurs. Je suis capable de le prouver. Écrivez-moi dans PM, discutez-en.

  7. Netilar

    Je considère, qu'est-ce que c'est un thème très intéressant. Je suggère à tous de participer plus activement à la discussion.



Écrire un message