Informations

Interaction des triphosphates chargés avec la région de liaison de l'ATP dans les protéines

Interaction des triphosphates chargés avec la région de liaison de l'ATP dans les protéines


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Les interactions ADN-histone impliquent des groupes de chaînes latérales d'acides aminés chargés positivement neutralisant le phosphate chargé négativement du squelette sucre-phosphate. En est-il de même pour les sites de liaison de l'ATP sur les protéines ?

Dans la plupart des modèles que j'ai vus, il semble que la base, l'adénine, soit impliquée dans la liaison. Mais le triphosphate semble se lier spécifiquement aux chaînes latérales chargées positivement. J'ai un peu cherché sur Google, mais je n'ai pas vraiment trouvé de modèles décrivant cela. Est-ce que quelqu'un sait si c'est le cas ?


Sommaire

De nombreuses protéines qui se lient aux nucléotides triphosphates ATP et GTP ont un motif évolutif conservé - la boucle P - qui se lie à la partie phosphate de la molécule. Cela a la séquence, GGXXXGKS/T. Bien que la lysine basique conservée (K) interagisse avec deux des fragments phosphate chargés positivement, d'autres interactions impliquent Mg2+ les ions (avec lesquels les NTP sont toujours complexés) et les résidus d'acides aminés polaires, plutôt que chargés, et le squelette polypeptidique.

Illustration détaillée

Bien que la question porte sur l'ATP, j'ai choisi la protéine de liaison au GTP H-ras p21 comme illustration car le papier de Pai et al. sa description donne des détails complets sur les interactions des phosphates, qui sont essentiellement les mêmes pour l'ATP et le GTP. (De nombreux autres articles ont tendance à ne montrer que des diagrammes en ruban de la protéine.) Notez également que la structure cristalline était, par nécessité, un complexe avec l'analogue du GTP, GppNp. (Le GppNp n'est pas rapidement hydrolysé, contrairement au GTP lui-même.)

Dans ce cas, la boucle P évolutive conservée qui lie le phosphate a la séquence :

Gly Ala Gly Gly Val Gly Lys Ser 10 11 12 13 14 15 16 17

Une représentation tridimensionnelle de la région de liaison au phosphate est montrée ci-dessous. Le cadre de gauche montre la boucle P et les résidus Thr35 et Asp57 sans le nucléotide. Le cadre de droite est le même mais avec GppNp et un ion magnésium inclus, et seuls les résidus conservés de la boucle P sont marqués.

[Travail personnel basé sur la figure 6 de l'article de Pai et al. en utilisant le logiciel Jmol et le fichier de la banque de données de protéines 5p21.pdb.]

Un schéma bidimensionnel des interactions est présenté ci-dessous. Les interactions des chaînes latérales (et celles de l'ion magnésium) sont représentées par des lignes pointillées rouges, tandis que celles du squelette sont représentées en noir. Les résidus conservés de la boucle P sont indiqués en bleu.

[Redessin simplifié d'une partie de la Fig.5 de l'article de Pai et al., excluant les interactions de l'eau et les distances interatomiques.]

Réflexions

Bien que les chaînes latérales d'acides aminés basiques chargées positivement soient impliquées dans la neutralisation des charges négatives des acides nucléiques et des phosphates de nucléotides, elles ne sont pas le seul moyen de le faire, et dans le cas des NTP, elles ne sont pas le moyen principal. Les ions magnésium et les résidus polaires (y compris le squelette protéique +ve groupes NH) peuvent jouer un rôle important. À mon avis, cela reflète deux choses. Premièrement, que la vie est dynamique ; les interactions les plus faibles sont donc souvent favorisées dans les enzymes car elles peuvent être facilement brisées ainsi que fabriquées. (Le NDP doit être libéré de l'enzyme après hydrolyse.) Deuxièmement, et de façon plus spéculative, on pense que la boucle P est très ancienne car elle se trouve dans une grande variété de protéines de liaison NTP conservées. Une conformation spécifique du squelette a été identifiée qui facilite cette interaction. Il aurait pu survenir avant que les 20 protéines (ish) spécifiées par le code génétique ne soient apparues, alors que le squelette protéique aurait pu jouer un rôle plus important dans l'interaction avec les petites molécules. (Cela a également été suggéré pour les groupes NH du squelette liant le soufre +ve dans les clusters fer-soufre.)


Transporteur de cassettes à liaison ATP

Les Transporteurs de cassettes à liaison ATP (transporteurs ABC) sont une superfamille de systèmes de transport qui est l'une des plus grandes et peut-être l'une des plus anciennes familles de gènes. Il est représenté dans tous les phylums existants, des procaryotes aux humains. [1] [2] [3]

Les transporteurs ABC sont souvent constitués de plusieurs sous-unités, dont une ou deux sont des protéines transmembranaires et une ou deux sont des AAA ATPases associées à la membrane. Les sous-unités ATPase utilisent l'énergie de la liaison et de l'hydrolyse de l'adénosine triphosphate (ATP) pour fournir l'énergie nécessaire à la translocation des substrats à travers les membranes, soit pour l'absorption soit pour l'exportation du substrat.

La plupart des systèmes d'absorption ont également un récepteur extracytoplasmique, une protéine de liaison au soluté. Certaines ATPases homologues fonctionnent dans des processus non liés au transport tels que la traduction de l'ARN et la réparation de l'ADN. [4] [5] Les transporteurs ABC sont considérés comme une superfamille ABC sur la base des similitudes de la séquence et de l'organisation de leurs domaines de la cassette de liaison à l'ATP (ABC), même si les protéines membranaires intégrales semblent avoir évolué indépendamment plusieurs fois, et comprennent donc différentes familles de protéines. [6] Comme les exportateurs d'ABC, il est possible que les protéines membranaires intégrales des systèmes d'absorption d'ABC aient également évolué au moins 3 fois indépendamment, sur la base de leurs structures tridimensionnelles à haute résolution. [7] Les porteurs d'absorption ABC absorbent une grande variété de nutriments, de précurseurs biosynthétiques, de métaux traces et de vitamines, tandis que les exportateurs transportent des lipides, des stérols, des médicaments et une grande variété de métabolites primaires et secondaires. Certains de ces exportateurs chez l'homme sont impliqués dans la résistance aux tumeurs, la mucoviscidose et une série d'autres maladies humaines héréditaires. L'expression de haut niveau des gènes codant pour certains de ces exportateurs dans les organismes procaryotes et eucaryotes (y compris l'homme) entraîne le développement d'une résistance à de multiples médicaments tels que les antibiotiques et les agents anticancéreux.

Des centaines de transporteurs ABC ont été caractérisés à la fois chez les procaryotes et les eucaryotes. [8] Les gènes ABC sont essentiels à de nombreux processus dans la cellule, et les mutations des gènes humains provoquent ou contribuent à plusieurs maladies génétiques humaines. [9] Quarante-huit gènes ABC ont été signalés chez l'homme. Parmi celles-ci, nombre d'entre elles ont été caractérisées et montrées comme causalement liées à des maladies présentes chez l'homme telles que la mucoviscidose, l'adrénoleucodystrophie, la maladie de Stargardt, les tumeurs résistantes aux médicaments, le syndrome de Dubin-Johnson, la maladie de Byler, la cholestase intrahépatique familière progressive, la sidéroblastique liée à l'X. anémie, ataxie et hypoglycémie persistante et hyperinsuliménique. [8] Les transporteurs ABC sont également impliqués dans la résistance multiple aux médicaments, et c'est ainsi que certains d'entre eux ont été identifiés pour la première fois. Lorsque les protéines de transport ABC sont surexprimées dans les cellules cancéreuses, elles peuvent exporter des médicaments anticancéreux et rendre les tumeurs résistantes. [dix]


Matériaux et méthodes

Préparation des substrats de réticulation

Le plasmide pET21b-pS-protA codant pour la préprotéine pS-protA a été construit comme décrit précédemment (Schnell et Blobel, 1993). Le plasmide pET21b-pFd-protA-1 codant pour pFd-protA-1 a été généré par mutagenèse dirigée par PCR de pET-pFd-protA (Ma et al., 1996) avec des amorces qui ont introduit les changements suivants dans la région codante de pFd : une méthionine à la conversion de la cystéine en position -1 et une insertion glutamate-phénylalanine en position +4. Le reste de la séquence pFd-protA-1 était identique à pFd-protA (Ma et al., 1996). Le plasmide pET21b-pS-protA-1 codant pour pS-protA-1 a été généré par mutagenèse dirigée par PCR de pET21b-pS-protA pour changer la cystéine en position -1 en sérine. Le reste de la séquence pS-protA-1 était identique à pS-protA. Le plasmide pET21b-pS-protA-2 codant pour pS-protA-2 a été généré par mutagenèse dirigée par PCR de pET21b-pS-protA-1 avec des amorces qui ont introduit les changements suivants : une conversion de la valine en glutamate à la position +39 et l'élimination de la cystéine en position +41. Le reste de la séquence pS-protA-2 était identique à pS-protA-1.

Les polypeptides pS-protA, pS-protA-1, pS-protA-2 et pFd-protA-1 ont été exprimés en Escherichia coli BL21 (DE3) contenant des extensions COOH-terminales de six résidus histidine. Les préprotéines ont été purifiées à partir d'extraits par chromatographie d'affinité sur une matrice nickel-chélate selon les recommandations du fournisseur (Novagen, Inc., Madison, WI).

L'iodation du réactif de réticulation hétérobifonctionnel, N-[4[(p-azidosalicylamido)butyl]-3′(2-pyridyldithio)propionamide (APDP Pierce, Inc., Rockford, IL) et le couplage de [ 125 I]APDP aux préprotéines ont été réalisés comme décrit précédemment (Ma et al., 1996). Le rapport molaire de [ 125 I]APDP aux résidus de cysteine ​​pour chaque préprotéine était de 1,5:1 dans toutes les réactions de couplage. Les substrats de réticulation ont été conservés à -80°C dans 0,1 M NaHCO3, pH 9,0, contenant 8 M d'urée.

Isolement et sous-fractionnement des chloroplastes

Des chloroplastes intacts ont été isolés de semis de pois âgés de 10 à 14 jours (Pisum sativum variante Green Arrow) par homogénéisation et centrifugation sur gel de silice Percoll comme décrit précédemment (Pain et Blobel, 1987). Les chloroplastes isolés ont été remis en suspension dans 50 mM de Hepes-KOH, pH 7,7, 0,33 M de sorbitol (tampon HS) à une concentration équivalente à 2 à 3 mg de chlorophylle/ml.

Pour préparer des membranes d'enveloppe de chloroplaste, des chloroplastes intacts ont été lysés dans des conditions hypertoniques et séparés en fractions solubles et membranaires par centrifugation différentielle comme décrit par Keegstra et Yousif (1986). La fraction membranaire totale a été séparée en fractions membrane enveloppe et membrane thylacoïde par flottation en gradients linéaires de saccharose comme décrit précédemment (Schnell et al., 1994).

Réactions de liaison aux précurseurs et de réticulation

Les chloroplastes intacts isolés ont été incubés dans du tampon HS contenant 50 mM de KOAc, 4 mM de MgOAc (tampon d'importation) en présence de 400 nM de nigéricine pendant 15 min à 26°C dans l'obscurité pour les épuiser en ATP endogène. Toutes les réactions de liaison ont été effectuées dans l'obscurité en utilisant des chloroplastes équivalents à 2 mg de chlorophylle dans un volume de réaction de 1 ml. Pour la liaison du précurseur en l'absence d'ATP (liaison indépendante de l'énergie), 20 U d'apyrase (Sigma Chemical Co., St. Louis, MO) ont été ajoutés à la suspension de chloroplaste pendant la réaction de déplétion d'ATP. Pour la liaison du précurseur en présence d'ATP (intermédiaire d'importation précoce), des chloroplastes appauvris en ATP ont été incubés en présence de 0,1 mM de MgATP et 0,1 mM de MgGTP pendant 5 min à 26°C. Pour les réactions d'importation, des chloroplastes appauvris en ATP ont été incubés en présence de 2 mM de MgATP pendant 5 min à 26°C. Après les prétraitements, une préprotéine dénaturée par l'urée a été ajoutée à une concentration finale de 200 nM, et l'incubation a été poursuivie pendant 10 min (liaison indépendante de l'énergie et intermédiaire d'importation précoce) ou 20 min (étape d'importation tardive) à 26°C. Les chloroplastes ont été transférés dans la moitié inférieure d'une boîte de Pétri en verre sur de la glace et irradiés par le dessus avec un transilluminateur chromato-vu (UVP, Inc., Upland, CA) à 312 nm à une distance de 5 cm pendant 20 min avec agitation constante . Le traitement à la thermolysine des chloroplastes intacts a été effectué comme décrit précédemment (Cline et al., 1984) en utilisant 0,1 mg de thermolysine/ml pendant 30 min sur de la glace. Les chloroplastes ont été collectés par centrifugation pendant 30 s à 6 000 g dans une microcentrifugeuse, sous-fractionné comme décrit ci-dessus, et les fractions d'enveloppe ont été analysées par SDS-PAGE.

Analyse et quantification d'échantillons

Tous les échantillons réticulés ont été résolus par SDS-PAGE sur des gels de Polyacrylamide à 12 %. Les signaux radioactifs dans les gels séchés ont été capturés et quantifiés à l'aide d'un Phosphorimager SI (Molecular Dynamics, Inc., Sunnyvale, CA) avec le programme de traitement d'images scientifiques sur gel IPLab version 1.5c (Signal Analytics, Vienna, VA). Toutes les images de gels radioactifs ont été capturées à l'aide du logiciel IP Labgel. Des étiquettes d'images ont été ajoutées à l'aide du logiciel Canvas version 2.1 (Deneba Systems, Inc., Miami, FL) et les images ont été imprimées sur une imprimante XLS 8600 PS (Kodak, Rochester, NY).


Matériaux et méthodes

Clonage de protéines de fusion et mutagenèse dirigée

La séquence codante de l'homme HMGA1a a été amplifié par PCR sur 2 l d'ARN HepG2 reverse-transcrit en utilisant les amorces 5' ATGAGTGAGTCGAGCTCGAAGTCCAGC 3' et 5' ACTGCTCCTCCTCCGAGGACTCC 3' (Interactiva). Ce produit et tous les autres produits de PCR ont été sous-clonés par clonage TOPO™TA selon les instructions du fabricant (Invitrogen). L'ADNc de HMGA1 a ensuite été ÉcoRI inséré dans ou pEGFPN1 (Clontech).

La mutagenèse dirigée de HMGA1a humaine a été réalisée essentiellement comme décrit dans le protocole du kit de mutagenèse dirigée QuickChange® (Stratagene). Pour la mutation des sites de phosphorylation de hHMGA1a, des substitutions de codon alanine ont été introduites au niveau des nucléotides codant pour l'acide aminé thréonine aux positions 21 (T21A), 53 (T53A) et 78 (T78A) de la séquence de la protéine hHMGA1a comme indiqué ailleurs (Siino et al. , 1995).

Les mutations AT-Hook ont ​​été introduites par substitution glycine du codon arginine suivant le codon glycine central du motif AT-hook conservé PRGRP aux positions 28 (R28G), 60 (R60G) et 86 (R86G). Les amorces suivantes (Thermo Hybaid) ont été utilisées dans les réactions de PCR, respectivement : R28G 5′ CGGGGCCGGGGCGGGCCGCGCAAGCAG 3′ R28G reverse 5′ CTGCTTGCGCGGCCCGCCCCGGCCCCG 3′ R60G 5′ CCTAAGAGACCTCGGGGGCGGACCAAAGTGGAAGCC 3′ R60G reverse 5′ GCTGGTCGACCGACCGA GCCAG86TAGAGACCTCGGGGGCGGACCAAAGTGGAGCAAGC 3′ R60G reverse 5′ GCTGGTCGACCGACCAG86 5′ CTCCAGTTTTTTGGGTCCGCCCCTTGGTTTCCTTCC 3′. Des combinaisons de mutations ont été faites séquentiellement. Les clones dérivés ont été vérifiés par séquençage.

Transfection et traitements cellulaires

Les cellules HepG2 ont été transitoirement transfectées en utilisant effectene (Quiagen) et 400 ng d'ADN plasmidique comme spécifié par le fabricant. Les cellules transfectées ont été cultivées sur des lamelles pendant la nuit à 37°C et 5% de CO2 à 50 % de confluence. Le taux de transfection était d'au moins 50 %, mais habituellement supérieur à environ 60 %. L'expression de HMGA1a-GFP n'a pas interféré avec la croissance cellulaire sur plusieurs cycles cellulaires. Pour l'acétylation de la chromatine, les cellules ont été incubées avec 500 ng/ml de Trichostatine A (TSA, Calbiochem) pendant 2 heures. La roscovitine (25 µM, Calbiochem) a été incubée pendant 4 heures. Un inhibiteur spécifique perméable aux cellules de la protéine kinase C, myristoyl-Phe-Ala-Arg-Lys-Gly-Ala-Leu-Arg-Gln-OH (ICN Biomedicals), a été utilisé à 10 µg/ml pendant 4 heures.

Imagerie de cellules vivantes et analyses FRAP

Pour l'imagerie des cellules vivantes, les cellules ont été cultivées sur des lamelles qui ont été montées sur une chambre à lame avec un milieu de culture. Les cellules ont été analysées dans les 20 à 30 minutes suivantes à température ambiante avec un Leica TCS-SP. Expériences FRAP à 37°C, 5% CO2 ont montré maintenant des différences de cinétique de récupération par rapport à celles obtenues à température ambiante (non représentées). Les cellules ont été analysées à l'aide de la ligne laser à 488 nm pour la GFP d'un laser Ar/Kr (488 nm : 18 mW de sortie nominale, réglage du sténopé à 1 568 nm : 17 mW de sortie nominale, réglage du sténopé à 1, objectif néofluar x40, NA 1.25). Pour le blanchiment, un seul balayage a été acquis, suivi d'une seule impulsion de blanchiment de 1 seconde en utilisant un spot d'environ 1 um de rayon sans imagerie. Pour l'imagerie, la puissance laser a été atténuée à 4 % de l'intensité de l'eau de Javel. Des images à section unique ont ensuite été collectées à des intervalles de 1 seconde (20 images), des intervalles de 2 secondes (10 images), des intervalles de 5 secondes (10 images) et à des intervalles de 10 secondes (20 images). Pour réduire les mouvements chromosomiques dans les cellules mitotiques, des expériences FRAP ont été réalisées en présence de 10 M de taxol. La perte moyenne de fluorescence pendant l'imagerie était de 2 à 3 %. Les courbes de récupération FRAP ont été générées selon Phair et Misteli (Phair et Misteli, 2000) à partir d'images soustraites en arrière-plan. Les valeurs quantitatives représentent des moyennes d'au moins 10 cellules provenant de trois expériences indépendantes. Comme standards, nous avons utilisé GFP, H3-GFP et des cellules fixes. Certaines récupérations ont été observées qui étaient supérieures à 100 % en raison de la contribution du bruit électronique dans le système de détection. Étudiants t-test a été utilisé pour déterminer la signification statistique des résultats.

Microscopie à fluorescence et propagations de chromosomes natifs

Pour la contre-coloration de l'ADN avec Hoechst 33258, les cellules transfectées ont été brièvement perméabilisées avec 0,1 % de Triton pendant 1 minute puis fixées dans du formaldéhyde à 2 % dans du PBS pendant 10 minutes à température ambiante. Les cellules ont ensuite été perméabilisées avec 100 ul de Triton X-100 0,1% dans du PBS pendant 10 minutes à température ambiante et du Hoechst 33258 a été ajouté à une concentration finale de 500 ng/ml. Les cellules ont été lavées et montées dans du Mowiol comme décrit (Hock et al., 1998). Des cellules colorées au Hoechst ont été étudiées avec un microscope confocal à balayage laser en utilisant la raie laser 364 nm d'un laser Kr/Ar (Zeiss 510) ou sur un Zeiss Axiophot équipé d'un système numérique Pixera. La procédure d'immunofluorescence sur des cellules fixées au formaldéhyde était essentiellement telle que précédemment décrite (Hock et al., 1998). Les anticorps primaires utilisés pour les expériences d'immunofluorescence étaient anti-HMGA1 (don de Ray Reeves), anti-sc35 (dilution 1:2000 Sigma) et anti-histone H1 (dilution 1:20 ICN). La propagation des chromosomes indigènes était essentiellement telle que décrite (Christensen et al., 2002).

Coloration d'ADN, exécution sur transcription et extraction de sel in situ

Pour la coloration d'ADN in situ avec Hoechst, les cellules transfectées ont été perméabilisées avec 0,05 % de Triton X-100 dans du PBS contenant 10 ug/ml de Hoechst. Les cellules ont été incubées pendant 2 à 5 minutes et surveillées immédiatement. Une exposition plus longue à Hoechst a conduit au déplacement de HMGA1a-GFP.

La transcription continue in situ a été réalisée comme décrit précédemment (Hock et al., 1998). Après incorporation de BrUTP, les cellules ont été fixées et perméabilisées comme décrit ci-dessus. Le BrUTP incorporé a été détecté en utilisant un anti-BrdUTP (Roche, Mannheim, dilué à 1:25). Les coupes optiques ont été enregistrées avec un Leica TCS-SP à l'aide de l'objectif à immersion d'huile x40 néofluar (N.A. 1,25) avec un réglage sténopé à 0,8 et AOTF pour 488 nm à 35%, et AOTF pour 568 nm à 50%. Des signaux fluorescents de GFP et Texas-red ont été enregistrés simultanément. Des images dichromatiques ont été enregistrées en parallèle. Aucune diaphonie n'a été observée.

Pour l'extraction du sel in situ, les cellules cultivées sur des lamelles ont été lavées deux fois dans du PBS et incubées dans 3 ml de tampon cytosquelette [CSK 100 mM NaCl, 300 mM saccharose, 10 mM Pipes, pH 6,8, 3 mM MgCl2, 0,5 % de Triton X-100, 1 mM de PMSF, leupétine, pepstatine, bestatine et RNasine (MBI)] pendant 10 minutes à 4°C.La CSK a été retirée par pipetage et les cellules ont été fixées dans du formaldéhyde à 2 %, ou incubées davantage pour l'extraction du sel dans 3 ml de CSK avec 350 mM de NaCl pendant 5 minutes à 4°C ou incubées avec de la DNase I dans un tampon de digestion [comme CSK mais avec 50 mM NaCl et 20 U/ml de RNasine (MBI) et 200 U/ml de DNase I (Roche)] pendant 30 minutes à température ambiante. Les cellules ont ensuite été fixées et traitées pour des analyses d'immunofluorescence comme décrit ci-dessus.

Microscopie électronique

La localisation de HMGA1a-GFP au niveau ultrastructural a été réalisée essentiellement comme décrit précédemment (Hock et al., 1998) en utilisant des anticorps monoclonaux dirigés contre la GFP (Roche) à 3 g/ml et des anticorps secondaires couplés à des particules d'or de 12 nm (Dianova, dilué 1 :dix).

Analyses Western Blot et extraction au sel de protéines

Pour tester les propriétés d'extraction du sel des protéines de fusion HMGA1a-GFP, les cellules HepG2 ont été transfectées avec du HMGA1a-GFP humain ou GFP comme contrôle, ont été lavées deux fois avec du PBS puis incubées avec du PBS contenant 0,5% de Triton X-100 ou du PBS contenant 350 mM de sel et 0,5 % de Triton X-100 pendant 10 minutes à température ambiante. Les surnageants ont été collectés et solubilisés. Les protéines ont été précipitées avec de l'acétone glacée. Les protéines précipitées ont été lavées deux fois avec de l'acétone à 70 %, séchées à l'air et remises en suspension dans un tampon d'échantillon SDS.

SDS-PAGE et transfert sur nitrocellulose ont été effectués comme décrit précédemment (Hock et al., 1998). La dilution des anticorps primaires pour les immunoblots était de 0,2 µg/ml pour l'anti-GFP (Roche), 0,5 µg/ml pour l'anti-HMGA1a (Santa Cruz), 0,3 µg/ml pour l'anti-pep2 (Hock et al., 1998). L'anticorps monoclonal dirigé contre l'actine (Gonsior et al., 1999) a été utilisé à une dilution de 1:1000. Le blocage et l'incubation ont été effectués dans du lait écrémé en poudre à 5 %/TBS pendant 1 heure à température ambiante, sauf pour l'anticorps HMGA1, où le blocage était dans du TBS plus 0,1 % de Tween-20. Le lavage et la détection ont été effectués comme décrit.


Matériaux et méthodes

Élevage.

Cette étude a été examinée et approuvée par le comité institutionnel de protection et d'utilisation des animaux de l'Université de Washington. Des souris mâles CB6F1 (BL/6 : BalbC) âgées de 36 à 37 mois ont été reçues de la colonie de souris âgées du National Institute of Aging. Toutes les souris ont été maintenues à 21 °C sur un cycle lumière/obscurité de 14/10 et ont reçu de la nourriture pour souris standard et de l'eau à volonté sans déviation avant ou après les procédures expérimentales. Les animaux ont été sacrifiés par dislocation cervicale sans anesthésie.

Extraction de tissus, isolement mitochondrial et traitement SS-31.

Le jour de l'abattage des animaux, le cœur (120 à 150 mg de poids humide) a été réséqué. Le cœur entier a été homogénéisé sur de la glace dans un homogénéisateur en verre Dounce dans 2 ml de tampon de respiration glacé (RB, 1 mM EGTA, 5 mM MgCl2, 105 mM K-MES, 30 mM KCl, 10 mM KH2Bon de commande4, pH 7,1). Les homogénats ont été centrifugés pendant 10 min à 800 × g à 4°C. Les surnageants ont été collectés et centrifugés pendant 15 min à 8.000 à 10.000 × g à 4°C. Après élimination du surnageant, le culot a été remis en suspension dans du milieu d'isolement. Le culot a été centrifugé pendant 15 min à 8.000 à 10.000 × g à 4°C et remis en suspension dans un milieu d'isolement. Les culots mitochondriaux ont été séparés dans de nouveaux tubes à centrifuger et dilués avec 200 L de RB, 10 mM de pyruvate et 2 mM de malate. De l'élamiprétide ou 2 L de solution saline ont été ajoutés aux mitochondries et incubés pendant 1 h à température ambiante avec une légère oscillation.

Essais fonctionnels ex vivo et in vivo.

Respiration mitochondriale et H2O2 la production a été dosée dans des mitochondries isolées de cœurs de souris jeunes (5 à 7 mois) et âgés (36 à 37 mois) ou de muscles gastrocnémiens comme décrit ci-dessus en présence ou en absence de 10 M de bSS-31 , en utilisant un double respiromètre/fluoromètre Oxygraph 2K (Oroboros Instruments). Afin d'évaluer la sensibilité à l'ADP in vivo, nous avons réanalysé les données de Siegel et al. (30). Le superoxyde mitochondrial a été quantifié par le rapport de mitoSOX à mitoTrackerGreen en utilisant la microscopie confocale Leica SP8X. De plus amples détails sur ces tests sont disponibles dans Annexe SI, Matériaux et méthodes SI.

Réaction de réticulation.

Le cross-linker amide-DP-NHP (synthèse décrite dans Annexe SI, Matériaux et méthodes SI) a été ajouté à une concentration finale de 10 mM (à partir d'une solution mère de 270 mM) aux mitochondries incubées avec bSS-31. Le mélange réactionnel a été mélangé à 800 tr/min à température ambiante pendant 30 min. Au total, cinq échantillons réticulés ont été générés, dont quatre réplicats biologiques de mitochondries cardiaques de souris incubées avec bSS-31 et un échantillon témoin négatif auquel aucun bSS-31 n'a été ajouté. Après réticulation, les échantillons ont été congelés à -80°C.

Préparation d'échantillons mitochondriaux réticulés.

Des échantillons mitochondriaux réticulés ont été lysés avec 8 M d'urée dans 0,1 M de NH4HCO3. La protéine extraite a été digérée avec de la trypsine et les peptides réticulés bSS-31 ont été enrichis avec de l'avidine monomère comme décrit en détail dans Annexe SI, Méthodes et matériaux SI.

Analyse LC-MS de paires de peptides réticulés.

Les échantillons ont été analysés par LC-MS en utilisant deux méthodes développées pour l'analyse de paires de peptides réticulés, à savoir ReACT (33) et Mango (34). L'analyse ReACT a été réalisée sur un spectromètre de masse Velos-FTICR (Fourier-transform ion cyclotron resonance) couplé à un Waters nanoAcquity UPLC (ultra performance liquid chromatography).

Les échantillons ont été analysés par Mango en utilisant un spectromètre de masse Thermo Q-exactive plus couplé à un Thermo Easy nLC. Voir Annexe SI, Matériaux et méthodes SI pour plus de détails sur la LC-MS.

L'analyse des données.

Les fichiers de données LC-MS au format .RAW ont été convertis au format .mzXML à l'aide de l'outil ReADW de la suite logicielle Trans Proteomic Pipeline (93). Comet (94) a été utilisé pour rechercher les fichiers.mzXML par rapport à la base de données Mitocarta 2 (39) contenant à la fois des séquences de protéines directes et inverses (2 084 séquences totales) ainsi que l'ajout de la séquence pour bSS-31 (Biotine-D-Arg- diméthyl Tyr-Lys-Phe-NH2). Pour plus de détails voir Annexe SI, Matériaux et méthodes SI.

Amarrage moléculaire.

Un modèle moléculaire pour bSS-31 a été généré à l'aide d'Avogadro (v. 1.2.0) en utilisant une recherche de conformères de mécanique moléculaire de 1 000 conformères suivie d'une optimisation géométrique. PatchDock (35) a été utilisé pour ancrer le modèle de bSS-31 avec des modèles structuraux dans le PDB pour les protéines interagissant avec le bSS-31 (AATM = PDB : 3pdb, ADT c-state = PDB : 2c3e, ADT m-state = PDB : 6gci , ATPA/ATPB = PDB : 5ARA, QCR2/QCR6 = PDB : 1sqp, NDUA4 = PDB : 5z62, ECHA = PDB : 6dv2, IDHP = PDB : 5h3f et KCRS = PDB : 1crk). Clustal Omega (36) a été utilisé pour aligner chaque protéine de souris avec des structures homologues d'autres espèces. Pour chaque protéine, les 10 meilleurs modèles amarrés de PatchDock ont ​​été téléchargés et l'interface d'interaction avec bSS-31 a été définie comme les résidus d'acides aminés dans les 5 du volume de surface encapsulant les positions atomiques de bSS-31.

Disponibilité des données.

Toutes les données de réticulation biotinylée-SS-31 présentées dans cet article sont disponibles dans la base de données XLinkDB à l'adresse : xlinkdb.gs.washington.edu/xlinkdb/BiotinylatedSS31_Bruce.php. Les données LC-MS ont été déposées dans les archives PRIDE (https://www.ebi.ac.uk/pride/archive) avec le numéro d'accès. PXD019484.


Un aperçu structurel des hélicases DDX humaines impliquées dans l'interaction COV

Les hélicases DDX humaines appartiennent à la famille des protéines DEAD-box, qui est la plus grande famille des hélicases de la superfamille 2 (SF2) (Byrd et Raney, 2012). Ils partagent un noyau d'hélicase hautement conservé constitué de deux domaines de type RecA (D1 et D2) connectés via une région de liaison flexible (Hilbert et al., 2009). Ces deux domaines, également appelés domaine DEAD et domaine hélicase, sont caractérisés par la présence de neuf motifs conservés, Q, 1, 1a, 1b, II, III, IV, V et VI, et du tétrapeptide commun (Asp-Glu -Ala-Asp) dans le motif II (figure 5A). Dans de nombreuses hélicases DEAD box, les domaines D1D2 sont liés à des régions flanquantes distinctes ou à des domaines auxiliaires, dont la longueur varie de quelques à plusieurs centaines d'acides aminés (Rudolph et Klostermeier, 2015). Ces domaines variables N-terminaux et C-terminaux contribuent à la diversité fonctionnelle de cette famille de protéines, et dirigent des hélicases individuelles vers leurs cibles via une interaction protéine ou ARN ou en modulant l'activité du cœur de l'hélicase (Del Campo et Lambowitz, 2009 Mallam et al., 2011 Ferrage et al., 2012 Rudolph et Klostermeier, 2015). Les études structurelles sur les hélicases DDX, rapportées dans les tableaux 2 et 3, sont principalement axées sur le cœur de l'hélicase ou des domaines auxiliaires isolés, avec peu de structures d'hélicases pleine longueur. Néanmoins, le patch conservé dans le cœur des hélicases fournit des informations importantes sur leur activité. Dans les protéines DDX, les deux domaines de type RecA sont tous deux responsables de la liaison à l'ARN et de l'hydrolyse de l'ATP (Hilbert et al., 2009). Plus précisément, les motifs conservés Q, I (boucle P), II et VI participent à la liaison de l'ATP et le motif d'hydrolyse III est responsable du couplage de l'hydrolyse de la NTP au déroulement des acides nucléiques, et les motifs Ia, Ib, IV et V sont impliqués dans Liaison à l'ARN (Figure 5) (Hilbert et al., 2009).

Figure 5. (A) Organisation de domaine typique des hélicases DDX. Les motifs sont représentés avec des couleurs selon leur fonction principale (rouge, jaune de liaison à l'ATP et à l'hydrolyse, coordination entre les sites de liaison NTP et ARN bleu, liaison à l'ARN). (B) Représentation de bande dessinée montrant les mouvements de domaine dans les hélicases DDX lors de la liaison à l'ARN de la protéine DEAD-box eIF4AIII sans ARN (à gauche) et en complexe avec de l'ARN (à droite). Un fragment d'ARN et AMPPNP sont représentés en bâtonnet en vert et en cyan, respectivement.

Tableau 2. Similitude structurelle du SARS-CoV-2 Nsp13 avec les hélicases DDX humaines, telle que calculée par DALI.


Redistribution énergétique en allostère pour exécuter la fonction protéique

Une perturbation sur un site de la protéine pourrait provoquer un effet sur un site distant. Cet important phénomène biologique, appelé « effet allostérique », est essentiel pour la régulation des protéines et la signalisation cellulaire, jouant un rôle important dans la fonction cellulaire. Sa signification fonctionnelle fondamentale a inspiré de nombreux travaux visant à comprendre le fonctionnement de l'allostère. L'allostère peut impliquer des changements conformationnels importants ou non observés, subtils (principalement des chaînes latérales) (1). Les changements de conformation sont entraînés par l'enthalpie. Le terme « allostère dynamique » a été inventé par Cooper et Dryden au début des années 1980 pour décrire l'allostère « même en l'absence de changement de conformation macromoléculaire » (2). Cooper et Dryden ont soutenu que l'allostère dynamique est principalement un effet d'entropie. Cependant, de nombreux travaux ont été publiés au cours des 20 dernières années en prenant « allostère dynamique » pour impliquer une absence totale de changement conformationnel parce que les auteurs n'ont pas observé de tels changements (1). Il est important de noter que «l'allostère dynamique» sans changements de conformation observables est toujours régie par un changement de population entre deux états «distincts» où une nouvelle redistribution énergétique favorable à l'état allostérique (fonctionnel) est soit dominée par l'entropie, l'enthalpie ou les deux. Peu d'études se sont demandé si l'enthalpie joue également un rôle dans l'allostère dynamique (1). Dans le PNAS, Kumawat et Chakrabarty (3) démontrent qu'en effet, même dans l'allostère dynamique, l'enthalpie joue un rôle en redistribuant les énergies internes, en particulier les énergies d'interaction électrostatique, entre les résidus lors d'une perturbation (Fig. 1).

Le schéma de la base électrostatique de l'allostère dynamique dans la protéine du domaine PDZ3. L'allostère dynamique n'a pas de changement conformationnel significatif. Lors de la liaison du peptide (CRIPT), il n'y a pas de changement d'enthalpie significatif, mais Kumawat et Chakrabarty (3) ont rapporté une redistribution des énergies électrostatiques. Une telle redistribution peut se propager à d'autres domaines PDZ pour que les protéines exécutent leur fonction.

Electrostatics est un acteur reconnu de la fonction. Il y a des décennies, Warshel (4) et Warshel et al. (5) a démontré son rôle critique dans la catalyse des protéines et Perutz (6) dans l'allostère. Récemment, des réarrangements de réseaux électrostatiques ont été rapportés pour l'allostère conformationnellement conduit (7, 8). Le rapport sur les interactions électrostatiques cachées dans l'allostère dynamique dans PNAS (3) soutient que la redistribution de l'énergie d'interaction électrostatique pourrait être universelle dans les protéines allostériques, avec ou sans changement de conformation significatif.

Les protéines embrassent la redistribution des énergies d'interaction électrostatique pour exécuter leurs fonctions. Par exemple, la myosine, une protéine motrice, se lie à l'ATP chargé négativement, qui redistribue le réseau de liaisons électrostatiques, modifiant ainsi la charge du site de liaison de l'actine, conduisant à la dissociation de la myosine de l'actine (7). Ainsi, la myosine redistribue l'énergie d'interaction électrostatique dans l'allostère pour exécuter sa fonction de dissociation de l'actine.

La protéine du domaine PDZ est une protéine de signalisation cellulaire bien connue. Les principales fonctions des domaines PDZ comprennent la reconnaissance des motifs peptidiques C-terminaux désordonnés de centaines de récepteurs et de protéines à canaux ioniques, la dimérisation avec d'autres domaines modulaires et la liaison aux phospholipides. En tant que régulateur dynamique de la signalisation cellulaire, la fonction PDZ peut être modulée allostériquement (9). Dans la protéine du domaine PDZ3, le site de reconnaissance peptidique est situé dans la région hydrophobe β2–α2. Des mutations de résidus distaux sur le domaine PDZ3 ou une délétion de l'hélice α3 distale (10) affectent allostériquement l'affinité de liaison au site de reconnaissance sans provoquer de changement conformationnel significatif. En revanche, la liaison du peptide au site de reconnaissance modifie la dynamique du domaine PDZ3, bien que toujours sans grand changement conformationnel. En utilisant des simulations de dynamique moléculaire et l'analyse de l'énergie d'interaction protéique, Kumawat et Chakrabarty (3) montrent que la perturbation de la liaison d'un peptide dans la région β2–α2 conduit au réarrangement de la chaîne latérale de certains résidus chargés pour former de nouvelles interactions électrostatiques favorables. . En conséquence, certaines des interactions électrostatiques précédemment favorables à l'état non lié deviennent défavorables. Comme un effet domino, des réarrangements supplémentaires des chaînes latérales se produisent pour libérer ce stress énergétique, altérant le réseau de liaisons électrostatiques et hydrogène, en particulier dans les régions N- et C-terminales, conformément aux sites allostériques connus. Comment cette redistribution énergétique affecte-t-elle la fonction PDZ3 ? Les domaines PDZ sont généralement séquentiels sur la chaîne protéique. La redistribution énergétique dans un domaine PDZ peut se propager à travers un allo-réseau (11) vers un second domaine PDZ, affectant ainsi la signalisation cellulaire. Il est difficile de détecter cette redistribution dramatique de l'énergie dans les expériences, car la redistribution énergétique ne modifie pas l'énergie interactive totale en raison de l'annulation des interactions favorables et défavorables.

Kumawat et Chakrabarty (3) ont démontré la base électrostatique cachée sur la protéine de domaine PDZ3, soulevant la question de savoir si la redistribution d'interaction électrostatique est une caractéristique commune parmi les protéines allostériques « conduites par la dynamique » avec un changement conformationnel mineur, ou si c'est une caractéristique unique de la protéine du domaine PDZ3. PDZ3 reconnaît le peptide à travers sa poche hydrophobe, mais un résidu chargé positivement, K5, initie le réarrangement du réseau de liaison H, conduisant à des changements dans les énergies d'interaction électrostatique (3). Une question qui se pose est de savoir si le résidu chargé à l'interface de liaison est critique pour la redistribution de l'énergie d'interaction électrostatique. Par exemple, la protéine activatrice de catabolite cAMP (CAP) a été considérée comme une protéine allostérique classique axée sur la dynamique. La liaison d'un AMPc au CAP diminue l'affinité de liaison pour un deuxième AMPc de manière allostérique, cependant, même si la RMN suggère l'absence de changement de conformation, les structures cristallines de cAMP-CAP ultérieures (12, 13) ont indiqué que de grands changements de conformation sont nécessaires pour sa fonction de liaison à l'ADN ( 14). Fait intéressant, des mutations de CAP pour réduire son contact avec l'AMPc peuvent améliorer cette coopérativité allostérique négative (15). Notez que les résidus chargés sont impliqués dans l'interface d'interaction entre CAP et AMPc. On peut alors supposer que ces résidus chargés, qui sont perturbés par la liaison, déclenchent une redistribution de l'énergie d'interaction électrostatique interne et jouent ainsi un rôle dans la fonction allostérique de CAP. Les protéines kinases ont également été proposées comme étant des protéines allostériques dynamiques (16), où l'allostère est orchestrée par un noyau hydrophobe dynamique (17). Comme l'effet papillon, une seule mutation dans le cancer peut remodeler la cellule entière (18). Fait intéressant, bon nombre des mutations cancéreuses fréquentes impliquent des résidus chargés, tels que la mutation cancéreuse BRAF V600E. Cela soulève la question de savoir si ces mutations de résidus chargés déclenchent une redistribution des énergies internes au sein de la protéine et entre les protéines par le biais de déplacements allo-réseau (11) des chaînes latérales, ce qui pourrait expliquer en partie l'effet papillon dans le cancer.

Les interactions électrostatiques ne sont pas la seule source de redistribution énergétique. Kumawat et Chakrabarty (3) rapportent que les interactions de Van de Waals et les réseaux à liaison H sont tous deux impliqués dans une certaine mesure dans la redistribution énergétique. L'énergie d'une protéine représente toutes les interactions potentielles locales et à longue distance au sein et entre les résidus. Dans une protéine, plusieurs réseaux d'interaction d'acides aminés peuvent être identifiés pour décrire différentes interactions (19). En cas de perturbation, un ou plusieurs réseaux d'interaction d'acides aminés pourraient être modifiés, à des degrés divers, et l'énergie pourrait être redistribuée. La protéine n'est pas un système isolé mais interagit avec son environnement, y compris les molécules d'eau. Kumawat et Chakrabarty (3) ont remarqué un changement important de l'environnement de solvatation locale pour certains résidus, indiquant que la redistribution énergétique n'est pas seulement à l'intérieur ou entre les protéines. Les interactions protéine-eau contribuent également à la redistribution énergétique.

Comment unifier la base électrostatique et la base dynamique dans l'allostère dynamique ? Des études antérieures ont avancé l'entropie en tant que force motrice de l'allostère dynamique. Récemment, quelques rapports informatiques et expérimentaux ont suggéré que le principe de La Châtelier pourrait être à l'origine de l'allostère dynamique. À l'aide d'une méthode de simulation de dynamique moléculaire à balayage de résidus rigides, Kalescky et al. (20, 21) ont rapporté que la diminution de l'entropie locale en augmentant la rigidité des résidus individuels des protéines du domaine PDZ conduit souvent à une augmentation de l'entropie configurationnelle globale. Récemment, des expériences biophysiques réalisées par Law et al.(22) ont révélé que le volume de la protéine du domaine PDZ3 est couplé à un mouvement interne local, suivant le principe de La Châtelier. Fait intéressant, la suppression de l'hélice α3 au site distal diminue l'affinité de liaison mais augmente le volume et l'entropie de la protéine. Du point de vue de la redistribution énergétique, la perte d'entropie locale déclenche la redistribution de l'entropie globale pour équilibrer la perte d'entropie locale. Ainsi, l'allostère dynamique peut également être considérée comme la redistribution de l'entropie. Cependant, l'agencement des chaînes latérales pour avoir le déplacement de population des réseaux d'acides aminés (électrostatique, réseau à liaison H, etc.) est le résultat de la dynamique des chaînes latérales. Par conséquent, nous pouvons unifier la base d'enthalpie et d'entropie de l'allostère dynamique et conformationnelle par la redistribution de l'énergie et proposer que la fonction allostérique puisse être exécutée par la redistribution de l'énergie interne lors de la perturbation de l'énergie externe. Les observations de Kumawat et Chakrabarty (3) sont donc importantes pour recentrer les vues actuelles. Plutôt que de classer l'allostère comme entropique ou dynamique, ils soutiennent que pour la protéine du domaine PDZ3, elle doit être considérée en termes de redistribution interne et de déplacement de population d'interactions électrostatiques spécifiques. Les études futures devraient explorer la généralité de ces résultats et leurs prédictions dans la signalisation cellulaire et la découverte de médicaments.


Partie 2 : Réactions à la GTPase et maladies

00:00:00.14 Bonjour. Je m'appelle Fred Wittinghofer.
00:00:02.18 Je suis chef de groupe émérite à l'Institut Max Planck de physiologie moléculaire à Dortmund, en Allemagne.
00:00:11.08 Et c'est mon deuxième séminaire
00:00:14.01 et dans le premier, je vous ai présenté les commutateurs moléculaires appelés protéines de liaison GTP ou protéines G.
00:00:21.15 Et dans cette deuxième partie je me concentrerai davantage sur un aspect particulier de notre recherche qui est
00:00:28.20 traitant du mécanisme des réactions GTPase et de la manière dont elles conduisent à un certain nombre de maladies différentes.
00:00:34.09 Et je vais évidemment me concentrer principalement sur les protéines de type Ras dont j'ai parlé lors de mon premier séminaire.
00:00:42.23 Donc, encore une fois, brièvement, le cycle mécanistique de ces protéines :
00:00:49.25 Ils se présentent sous deux saveurs, ces protéines, l'état lié au GDP et lié au GTP.
00:00:55.13 Ils ont des nucléotides très étroitement liés.
00:00:58.03 Ils ont besoin d'un facteur d'échange de nucléotides de guanine pour libérer le PIB pour le GTP
00:01:03.23 car dans la cellule, il y a plus de GTP que de PIB.
00:01:06.11 C'est pourquoi la protéine se charge de GTP une fois que le GDP est éteint.
00:01:10.06 Ils ont un effet en aval dans la forme liée au GTP interagissant avec certaines protéines partenaires.
00:01:15.10 Et pour que le commutateur soit à nouveau éteint, vous avez la réaction GTPase
00:01:20.27 où la protéine divise le GTP en GDP et Pi.
00:01:24.29 Et cette réaction est très lente et est catalysée par des protéines appelées GTPase Activating Proteins
00:01:31.06 qui sera évidemment la chose principale dont nous parlerons.
00:01:36.24 Donc ce dont nous parlons, vraiment, c'est d'une réaction biochimique vraiment basique
00:01:43.23 à savoir, l'hydrolyse des phosphoanhydrides et c'est similaire à l'hydrolyse des phosphoesters.
00:01:53.08 Par exemple, lorsque vous avez des protéines phosphorylées qui sont phosphorylées sur la thréonine, la sérine ou la tyrosine,
00:01:57.24 vous avez une attaque nucléophile similaire sur le phosphate par l'eau.
00:02:05.04 Et évidemment, les gens ont beaucoup parlé de cette réaction parce que c'est un très
00:02:12.15 réaction lente car les phosphates sont fortement chargés négativement
00:02:19.16 et l'approche d'un nucléophile, par exemple une eau qui est également partiellement chargée négativement,
00:02:25.06 est très, très défavorisé. Et c'est pourquoi cette réaction est normalement très lente.
00:02:30.25 Ainsi, même si la réaction fournit de l'énergie,
00:02:33.17 c'est très lent car il faut surmonter l'énergie d'activation très élevée
00:02:38.16 qui dépend de ce que je viens de vous dire—les charges négatives.
00:02:42.04 Et plus l'énergie d'activation est élevée, vous le savez peut-être grâce à vos cours de biophysique,
00:02:46.13 que plus l'énergie d'activation est élevée, plus la réaction est lente,
00:02:51.00 parce que la vitesse de réaction est directement proportionnelle à l'énergie d'activation.
00:02:54.18 Ainsi, la nature utilise des enzymes pour abaisser l'énergie de l'état de transition
00:03:00.27 et ainsi rendre la réaction plus rapide.
00:03:03.15 Et il y a un article intéressant que je porte tout le temps à l'attention de mes étudiants
00:03:07.21 de Francis Westheimer qui a écrit un article il y a de nombreuses années :
00:03:12.01 Pourquoi la nature choisit les phosphates.
00:03:13.25 Parce que les chimistes n'utilisent jamais le phosphate comme groupe partant
00:03:17.13 mais en biologie c'est un groupe de départ très fréquent
00:03:21.16 Donc, à cause de ce but ici, à cause de ce que j'ai montré ici
00:03:26.17 la liaison phosphoanhydride ou la liaison phosphoester est cinétiquement stable
00:03:32.06 en d'autres termes, vous pouvez avoir votre ATP ou GTP dans l'eau et il reste pour toujours ou s'hydrolyse très lentement.
00:03:39.22 Mais thermodynamiquement, c'est principalement instable.
00:03:43.00 Si vous utilisez une enzyme, elle diminue l'énergie d'activation -- vous pouvez faire cette réaction très rapidement.
00:03:47.14 C'est donc un article intéressant que je vous recommande de lire.
00:03:50.27 Par exemple, c'est pourquoi l'ADN est stable et c'est pourquoi l'ATP est une si merveilleuse source d'énergie
00:03:57.12 car il fournit en principe de l'énergie mais est stable en solution aqueuse.
00:04:03.28 Commençons donc par Ras et sa réaction GTPase médiée par GAP car
00:04:10.25 c'est vraiment le paradigme pour beaucoup de choses qui ont été développées par la suite.
00:04:15.24 Voici donc le Ras moléculaire. C'est une représentation en ruban de la structure
00:04:21.29 du domaine G de Ras.
00:04:24.16 Vous voyez son cœur en forme parce que.
00:04:27.17 évidemment nous l'aimons beaucoup et nous avons résolu la structure à Hiedelberg.
00:04:32.00 La publicité de la ville de Hiedelberg, Ich hab mein Herz in Hiedelberg verloren
00:04:36.04 ce qui signifie que j'ai perdu mon cœur à Hiedelberg.
00:04:37.27 Mais la raison la plus importante pour laquelle il est en forme de cœur est que
00:04:41.13 les gens l'appellent le cœur battant de la transduction du signal.
00:04:44.06 Et c'est donc l'une des molécules les plus importantes qui régule
00:04:48.14 importants processus de transduction de signaux comme la croissance, la différenciation et parfois même l'apoptose.
00:04:54.17 Et vous connaissez probablement un peu le processus de transduction du signal parce que
00:04:59.07 chaque manuel a cette version, l'un des paradigmes de la chaîne de transduction du signal
00:05:04.01 où, par exemple, un facteur de croissance se lie à la membrane cellulaire
00:05:08.27 et se lie à son récepteur de facteur de croissance RTK (récepteur tyrosine kinase)
00:05:14.22 par lequel cela devient phosphorylé. Il recrute le facteur d'échange SoS
00:05:19.04 qui active ensuite Ras vers la forme liée au PIB.
00:05:22.16 Et puis, maintenant, Ras interagit avec le composant en aval qui est la Raf kinase
00:05:26.15 qui est la kinase de départ pour ce qu'on appelle le module MAP kinase.
00:05:30.24 Là, une kinase active la prochaine kinase en aval qui est appelée MAP kinase kinase kinase.
00:05:36.29 MAP kinase kinase kinase active MAP kinase kinase et qui activent MAP kinase
00:05:40.28 qui entre ensuite dans le noyau et active la transcription.
00:05:45.03 C'est donc une version très simplifiée de ce que Ras fait réellement.
00:05:48.16 et c'est le premier à être découvert (la première transduction de signal).
00:05:54.15 Mais maintenant, cela devient de plus en plus compliqué.
00:05:57.26 Ceci est encore une version très simplifiée mais elle vous montre déjà
00:06:00.27 la chose principale à propos de la transduction du signal via Ras est que de nombreux composants en amont viennent activer Ras.
00:06:09.18 Il s'agit soit de récepteurs à tyrosine kinase, soit de récepteurs couplés à la protéine G
00:06:13.09 ou les récepteurs des cellules T. Tous peuvent activer Ras.
00:06:16.08 Et puis Ras peut activer, en aval, de nombreux composants, pas seulement la Raf kinase
00:06:20.18 mais aussi une molécule appelée Ral GEF, PI(3) kinase, PLC epsilon et autres.
00:06:26.22 Et ils médient un certain nombre de réactions de transduction de signal
00:06:32.12 qui sont en quelque sorte intégrés quelque part, disons dans le noyau,
00:06:38.00 par un facteur de transcription et initier, quand le seuil est juste, quand le nombre de réaction est juste,
00:06:46.15 il initie une réponse cellulaire qui peut être une prolifération ou une différenciation ou autre.
00:06:52.03 Et je n'aborderai aucun aspect de cela parce que je veux me concentrer sur la réaction d'extinction.
00:06:57.28 Donc, la réaction de désactivation est à nouveau le schéma que vous avez vu, maintenant, plusieurs fois
00:07:03.25 mais ce qui se passe à Ras est aussi un oncogène
00:07:06.26 un oncogène qui a deux types de mutations, soit la glycine 12 muté en tout autre acide aminé
00:07:13.10 ou glutamine 61 muté en tout autre acide aminé.
00:07:16.21 Et ce que cela fait biochimiquement, c'est qu'il bloque la réaction GTPase médiée par GAP.
00:07:23.21 Vous pouvez donc imaginer ce qui se passe, vous avez bloqué le retour à l'état inactif
00:07:29.13 et c'est pourquoi vous accumulez maintenant des Ras sous la forme liée au GTP.
00:07:33.09 Vous n'avez plus besoin de la signalisation en amont car Ras est déjà dans l'état lié au GTP.
00:07:39.03 Et maintenant, il a un effet qui n'est plus régulé et c'est pourquoi il conduit au cancer.
00:07:44.14 Donc ces mutations simples. et c'est pourquoi, évidemment, en tant que biochimistes structurels
00:07:49.23 c'est un projet très intéressant de poser la question :
00:07:52.00 Comment se fait-il qu'une seule mutation ponctuelle ait des conséquences aussi dramatiques ?
00:07:58.19 Et c'est aussi. évidemment puisque Ras est l'oncogène le plus fréquent.
00:08:02.28 Environ 25% des personnes qui viennent à la clinique ont diagnostiqué une tumeur,
00:08:09.07 ils ont une mutation Ras, l'une de celles que je vous ai montrées. Au moins ce sont les plus fréquents.
00:08:15.00 Donc, évidemment, chaque société pharmaceutique travaille également à essayer d'inhiber la voie Ras
00:08:20.29 et la signalisation Ras comme moyen de traiter les cancers médiés par Ras.
00:08:25.28 Et il existe de nombreuses approches auxquelles on peut penser.
00:08:30.17 Je viens d'en indiquer quelques-uns ici. Par exemple, vous pourriez penser à Ras. est farnésylé
00:08:36.25 à la cystéine C-terminale et il y a une enzyme appelée farnésyl transférase qui médie cette réaction.
00:08:44.18 Il existe des inhibiteurs de la farnésyl transférase qui sont en cours de test en clinique pour leur efficacité.
00:08:50.00 Mais vous pourriez aussi penser à peut-être inhiber l'interaction avec les effecteurs en aval.
00:08:54.15 C'est, par exemple, une structure que nous avons déterminée : le complexe entre Ras et Raf kinase (ou une partie de Raf kinase).
00:09:00.10 Ou vous pouvez même y penser. et c'est ce sur quoi nous travaillons encore.
00:09:04.21 Notre approche de rêve est. la caractéristique de base du Ras oncogène est qu'il ne peut pas hydrolyser le GTP.
00:09:12.09 Peut-on penser à fabriquer de petites molécules qui induiraient l'hydrolyse du GTP sur Ras oncogène ?
00:09:18.21 C'est probablement un projet de rêve et nous y travaillons toujours pour le rendre réalisable.
00:09:25.05 Mais je vais vous montrer, au cours de ma présentation de séminaire, que la raison pour laquelle nous pensons toujours que c'est possible
00:09:32.23 est que la chimie ne devrait pas être si difficile.
00:09:36.14 Et j'espère pouvoir vous convaincre et que vous finirez par m'accompagner sur ce point.
00:09:40.26 On parle donc ici d'une attaque nucléophile de l'eau sur le gamma phosphate du GTP
00:09:49.03 médiée par RasGAP et produit Ras-GDP et Pi. Une simple réaction biochimique
00:09:56.09 mais si cela ne fonctionne pas, cela entraîne des conséquences très drastiques, à savoir le cancer.
00:10:00.21 Alors tout d'abord (Et vous avez aussi vu cette photo un certain nombre de fois.
00:10:05.24 Ceci est ma diapositive d'introduction, toujours)
00:10:08.09 est que les deux acides aminés les plus fréquemment mutés
00:10:13.16 (l'un ou l'autre) dans les versions oncogènes de Ras, ils sont très proches du site actif.
00:10:18.07 Donc vous voyez le nucléotide ici : c'est le gamma phosphate
00:10:22.07 Et vous voyez c'est la glutamine 61 et c'est la glycine 12 sont très proches du site actif
00:10:28.10 évidemment, comme vous l'auriez probablement prédit ou pensé auparavant,
00:10:32.06 est qu'ils sont en quelque sorte impliqués dans la réaction GTPase.
00:10:35.22 Maintenant, nous allons évidemment vous montrer ce qu'ils font réellement et pourquoi la mutation conduit à un blocage de l'hydrolyse du GTP.
00:10:43.08 Et vous pouvez également voir ici à partir d'une représentation en surface du site actif de Ras
00:10:49.12 que si ce GTP. donc il est assis. il est lié à la surface
00:10:53.26 et vous voyez que le gamma phosphate est toujours accessible de l'extérieur
00:10:57.03 et ce sera important dans le contexte de ce dont je vais parler
00:11:01.12 et vous voyez aussi, la dernière fois, j'ai parlé de l'importance du magnésium.
00:11:05.20 S'il n'y a pas de magnésium autour de vous, vous n'avez pas non plus de réaction d'hydrolyse du GTP.
00:11:09.24 Ainsi, comme toujours dans un génome de mammifère, il n'y a pas qu'un seul RasGAP, mais plutôt 12 ou 13.
00:11:19.08 Et j'en ai indiqué ici quelques-uns.
00:11:24.06 Et vous voyez qu'ils contiennent tous un domaine particulier d'environ 330 résidus.
00:11:28.09 C'est le domaine RasGAP qui à lui seul est capable d'initier la réaction rapide d'hydrolyse du GTP.
00:11:36.17 Et vous voyez que toutes ces protéines sont composées de domaines différents.
00:11:43.03 Et certains sont similaires, d'autres très différents.
00:11:45.20 Et ils régulent évidemment Ras dans différents contextes de la cellule
00:11:50.04 en raison de leurs différents domaines qu'ils ont en plus.
00:11:53.15 Et je vais en parler un, le premier RasGAP découvert par Frank McCormick qui est P120GAP.
00:12:02.06 Et je parlerai plus tard de NF1
00:12:05.05 qui est un autre élément important pour la formation de tumeurs car c'est un gène suppresseur de tumeur.
00:12:12.04 Donc tout d'abord, et encore une fois pour vous le rappeler, l'hydrolyse intrinsèque du GTP est très lente.
00:12:17.23 Mais, si vous ajoutez la protéine d'activation GTPase, c'est rapide.
00:12:21.08 Donc ce que j'ai fait ici, c'est que je prends du GTP radioactif (marqué gamma, par exemple)
00:12:25.27 et ensuite je mesure la production de Pi au fil du temps.
00:12:29.26 Vous voyez, là-bas, cette réaction (c'est à température ambiante) est presque négligeable.
00:12:35.14 Il n'y a presque pas d'hydrolyse de Ras normal à température ambiante sans GAP.
00:12:40.12 Et si vous ajoutez maintenant une quantité particulière de RasGAP, vous voyez qu'il y a une réaction très rapide.
00:12:44.23 Beaucoup plus rapide.
00:12:46.04 Et dans des conditions limites, il s'agit en fait d'une stimulation d'environ 10^5 fois cette réaction.
00:12:53.10 C'est donc une façon de voir les choses.
00:12:57.05 Nous voulons analyser comment GAP intervient dans cette réaction rapide d'hydrolyse du GTP.
00:13:03.14 Donc, au départ, évidemment, vous vous demandez : quel pourrait être le mécanisme de l'hydrolyse
00:13:10.11 et quelle est l'étape catalysée par GAP ?
00:13:14.02 Vous pouvez penser que Ras-GTP est, en principe, une enzyme d'hydrolyse rapide du GTP
00:13:20.14 mais il doit entrer dans un état GTPase compétent par une réaction d'isomérisation.
00:13:26.15 Et c'est très lent et c'est catalysé par GAP.
00:13:28.29 Ou vous pourriez penser que la réaction de clivage réelle, passant de GTP à GDP Pi,
00:13:35.02 est très lent et est catalysé par GAP.
00:13:38.01 Ou vous pourriez même penser que tout cela est encore très rapide
00:13:41.09 mais la libération de Pi dans le produit est très lente et est catalysée par GAP.
00:13:47.08 Par exemple, si vous vous souvenez avoir entendu parler de l'hydrolyse de l'ATP sur la myosine,
00:13:53.26 la myosine est, par exemple, une GTPase très rapide mais la libération de Pi est très lente
00:13:59.00 et doit être catalysé par l'actine.
00:14:01.04 Donc, en d'autres termes, quelle est l'étape réelle catalysée par GAP dans ce cas particulier ?
00:14:07.10 Et je devrais dire que c'est la réaction de clivage elle-même
00:14:11.12 qui est le principal point d'attaque par la protéine activatrice de GTPase
00:14:16.21 et que ce n'est qu'en présence de GAP que les autres réactions
00:14:20.18 deviennent au moins partiellement limitant le débit, au moins la version Pi.
00:14:24.10 Et je vous le montrerai plus tard également.
00:14:27.29 Et même si je vous l'ai déjà montré, je vais le répéter.
00:14:32.12 Donc, ce que nous utilisons beaucoup dans nos études où nous faisons de la biochimie avec des nucléotides fluorescents,
00:14:38.20 nous utilisons un analogique mant- ou mGDP ou mGTP
00:14:42.29 où vous avez, sur le ribose, un groupe de reporters fluorescents.
00:14:46.24 Donc ce serait soit du désoxy ribose soit du ribose et sur le ribose par lequel vous avez lié
00:14:52.17 ces liaisons ester, le groupe mant qui est très sensible à l'environnement dans lequel il se trouve.
00:14:59.19 Et c'est pourquoi cela donne toujours de très beaux changements structurels comme je vais vous le montrer dans une minute.
00:15:07.10 Nous avons utilisé l'arrêt du flux pour mesurer les réactions rapides car, rappelez-vous, la réaction GTPase,
00:15:13.29 qui est lent en l'absence de GAP devient très rapide
00:15:17.15 et donc pour l'analyser en détail, nous devons utiliser une cinétique d'arrêt.
00:15:21.16 Donc ce que vous ferez, par exemple : vous avez Ras étiqueté avec
00:15:25.10 mant-GTP (c'est donc la version fluorescente de GTP)
00:15:28.16 et vous avez GAP et vous les avez tournés ensemble dans une cuvette de détection fluorescente
00:15:34.02 et vous avez le flux d'arrêt ici afin de
00:15:37.17 assurez-vous de ne mettre qu'une certaine quantité de liquide de ces deux seringues dans votre chambre de réaction.
00:15:44.07 Donc quand on fait ça, quand on a tourné ces deux choses ensemble, on voit qu'il y a
00:15:50.09 une augmentation fluorescente si vous utilisez Ras-mantGTP et une diminution.
00:15:54.09 L'augmentation, encore une fois, est très rapide.
00:15:56.25 Cela signifie que les deux protéines forment un complexe.
00:15:58.27 Et puis avec le temps, le complexe se dissocie car après hydrolyse, la neurofibromine ne se lie plus à Ras.
00:16:07.18 Et tout cela est terminé, comme vous pouvez le voir, après une seconde.
00:16:10.09 Donc, réaction de phospho-transfert très rapide en présence de quantités saturantes de GAP.
00:16:15.07 Et comme contrôle, nous utilisons Ras lié à un analogique, GppNHp,
00:16:21.25 où vous qu'entre le bêta et le gamma phosphate vous avez un groupe NH
00:16:25.16 qui ne peut plus être hydrolysé et maintenant vous avez aussi une augmentation très rapide
00:16:30.17 (qui est une formation complexe) mais pas de dissociation car cela ne peut pas être hydrolysé.
00:16:35.05 C'est donc aussi la preuve que la dissociation est due à l'hydrolyse du GTP.
00:16:40.21 On peut donc se demander : "Dans cette réaction ici, qu'en est-il sur GAP, quels résidus sur GAP,
00:16:50.01 sont impliqués dans la médiation de cette réaction d'hydrolyse rapide du GTP, cette stimulation 10^5 fois de la réaction ?"
00:16:58.17 Et évidemment, vous pensiez à quels résidus, quels acides aminés pourraient faire le travail.
00:17:03.16 Ou est-ce plus d'un acide aminé ?
00:17:05.16 Et en bon candidat, nous pensions à une arginine
00: 17: 08.16 parce que si vous regardez une autre protéine G, la protéine G-alpha (des protéines G hétérotrimériques)
00:17:15.02 on sait que cela se compose de deux domaines
00:17:18.25 donc ce domaine bleu est le domaine G et le truc rouge ici est un domaine supplémentaire hélicoïdal.
00: 17: 24.21 Mais dans ce domaine hélicoïdal, vous avez une arginine qui se trouve juste, en plein dans le site actif
00:17:29.24 et il a été démontré que cette arginine est importante pour la réaction.
00:17:33.29 Et cela a été démontré, dans une très ancienne expérience
00: 17: 37.20 car il existe un agent pathogène bactérien appelé Vibrio cholera qui induit le choléra
00:17:45.29 et ce qu'il fait, c'est qu'il modifie réellement cette arginine sur cette protéine G-alpha.
00:17:51.16 Vous voyez, vous avez le NAD et la toxine cholérique transfère l'ADP-ribose sur
00:17:58.03 une arginine de G-alpha qui est montrée ici. C'est en fait du manuel ici.
00:18:02.26 C'est donc une très vieille réaction. Il avait été analysé il y a de nombreuses années.
00:18:07.10 Et ça se voit, quand vous faites cette réaction, quand vous bloquez
00:18:10.16 la réaction GTPase sur la protéine G-alpha, il n'y a plus d'hydrolyse GTP
00: 18: 16.10 et la protéine produit maintenant de l'AMP cyclique,
00:18:19.14 cela ouvre des canaux (canaux ioniques AMP cycliques) et ensuite vous obtenez tous ces symptômes du choléra.
00:18:26.19 Encore une fois, la question est : l'arginine serait-elle un bon candidat ?
00:18:29.29 Nous avons donc recherché l'arginine conservée dans tous les RasGAP que je vous ai montrés
00:18:33.24 et effectivement, nous en avons trouvé plusieurs, la plupart n'ont fait aucune différence.
00:18:38.06 Mais il n'y avait qu'une seule arginine qui, une fois mutée, montre le schéma suivant dans la réaction.
00:18:43.19 Donc, encore une fois, vous avez dans la version verte (c'est la version de type sauvage)
00:18:47.23 augmentation rapide due à la formation de complexes, diminution rapide due à la dissociation après hydrolyse du GTP.
00: 18: 53.16 Et avec ces mutants ici, l'arginine a muté en lysine ou en alanine
00: 18: 58.11 ou tout ce sur quoi vous aimeriez le muter,
00:19:00.03 il y a à nouveau une augmentation de la réaction mais ensuite elle reste là-haut, aucune hydrolyse du tout.
00:19:06.13 Ou, au moins dans ces circonstances, jusqu'à une seconde, il n'y a pas d'hydrolyse.
00:19:10.16 Ce qui vous dit déjà, évidemment, que cette arginine doit être indispensable à la réaction.
00:19:18.02 Jusqu'ici tout va bien. La biochimie était claire
00:19:21.09 mais évidemment vous ne savez pas vraiment ce que fait l'arginine dans le contexte.
00:19:24.05 Vous pensez que vous avez une idée que cela pourrait aller dans le site actif
00:19:28.02 mais, encore une fois, nous devons attendre que la structure nous dise vraiment ce qu'elle fait.
00:19:33.21 Tout d'abord, permettez-moi de vous présenter un autre concept important pour analyser la réaction de phospho-transfert.
00:19:40.12 Et cela utilise des complexes de fluorure d'aluminium.
00:19:43.02 Vous vous demandez peut-être pourquoi une telle molécule inorganique serait importante
00:19:47.14 mais il s'avère que si vous regardez la nature de l'état de transition,
00:19:51.20 donc ce serait GTP attaqué par l'eau.
00:19:55.18 Vous avez un état de transition où le phosphate fait maintenant une chose triginale et plate
00:20:00.26 où l'oxygène nucléophile et l'oxygène du groupe partant de l'autre côté
00:20:08.22 sont les ligands axiaux de ce phosphate pentacoordonné
00:20:12.11 et cet état de transition peut être soit très serré (qui est alors appelé associatif)
00:20:18.16 ou très lâche selon la distance ici entre le phosphate et les deux ligands axiaux.
00:20:25.26 Et puis vous vous retrouvez avec, encore une fois, du phosphate tétragonal (ce phosphate sans Pi).
00:20:32.08 Et il s'avère que le fluorure d'aluminium
00: 20: 36.05 (qui a une distance entre l'aluminium et le fluorure très similaire à
00:20:39.23 entre le phosphate et l'oxygène et ils sont également très négatifs en électrons)
00:20:44.26 que c'est une très bonne imitation de l'état de transition de la réaction de phospho-transfert.
00:20:51.02 Le seul problème était que, par exemple la kinésine ou la myosine ou
00: 20: 56.28 de nombreuses autres enzymes de phospho-transfert utilisent le fluorure d'aluminium pour imiter le
00:21:02.07 gamma-phosphate à l'état de transition,
00:21:04.17 Ras ou Rho et toutes ces protéines de type Ras n'ont jamais montré cela.
00:21:08.25 Ici, vous voyez cette expérience.
00:21:11.19 Vous prenez Ras-mantGDP (il a un certain spectre d'émission fluorescente avec un maximum aux alentours de 440)
00:21:19.03 et maintenant vous ajoutez le GAP et avec un il n'y a aucun changement dans le spectre.
00:21:24.12 Donc rien ne se passe.
00:21:25.11 Mais si vous ajoutez maintenant du fluorure d'aluminium, vous voyez que maintenant vous obtenez d'abord un décalage vers le bleu
00:21:31.00 puis une augmentation de l'absorption.
00: 21: 37.11 Cela signifie qu'il existe un complexe trimérique entre Ras, NF1 et le fluorure d'aluminium
00:21:42.07 où le fluorure d'aluminium se trouve dans le site de liaison au phosphate gamma.
00:21:47.10 Et c'était très instrumental.
00:21:48.25 et au fait, si vous le faites maintenant sur des mutants oncogènes
00:21:52.02 dont nous savons qu'il n'hydrolyse pas le GTP et fait la même expérience,
00:21:55.15 vous voyez, en présence de fluorure d'aluminium et de Ras, il n'y a pas de changement fluorescent.
00:22:00.06 Et maintenant vous ajoutez NF1 et il n'y a pas d'augmentation de fluorescence
00:22:04.12 parce que vous avez une mutation (Q61L) qui ne s'hydrolyse pas.
00:22:08.13 Vous pouvez également prendre une mutation de NF1, par exemple avec la mutation arginine,
00:22:13.22 et encore une fois, il n'y aurait aucun changement.
00:22:16.05 Donc, en d'autres termes, ce que ces expériences nous disent encore, c'est que Ras dans une enzyme de phospho-transfert incomplète.
00:22:22.22 Il a besoin de la présence d'un GAP pour ressembler à une enzyme de phospho-transfert
00:22:28.05 et s'il y a une mutation qui bloque la réaction GTPase, que ce soit sur Ras ou sur NF1,
00:22:33.22 nous n'obtenons pas non plus de complexe de fluorure d'aluminium.
00:22:37.09 Alors évidemment, tout cela est bien en termes de biochimie
00:22:42.00 mais ce qui médie vraiment la réaction GTPase, la rapide,
00:22:47.22 nous pensons que cela ne peut être vérifié qu'en examinant la structure du complexe Ras et RasGAP.
00:22:55.29 Ceci est montré ici. C'était donc le paradigme pour analyser ce type de réaction.
00:23:02.06 Donc vous voyez, par exemple, en rouge vous voyez Ras et en bas en vert est le domaine RasGAP (P120 GAP).
00:23:09.13 Et ce que vous voyez alors, ici. si vous regardez très attentivement
00:23:12.04 vous voyez qu'il y a un résidu de GAP entrant dans le site actif.
00:23:17.14 Vous voyez ça quand ça revient. tu vois ça juste là.
00:23:21.01 Il y a un résidu d'arginine pointant vers le site actif de Ras
00:23:26.04 et ce qu'il fait est montré dans la diapositive suivante.
00:23:29.06 Tout d'abord, dans cette diapositive, cela montre que le fluorure d'aluminium est vraiment le triangle plat
00:23:34.00 qui se situe entre le groupe partant et l'eau nucléophile.
00:23:38.07 Il y a donc une imitation de l'état de transition.
00:23:39.28 Et vous voyez alors, également, quels sont les résidus qui interviennent dans l'hydrolyse rapide du GTP.
00:23:45.17 Donc ce serait le phosphate,
00:23:48.14 donc nous pensons maintenant que si nous supprimons le fluorure d'aluminium et
00:23:52.06 pensez à quoi ressemblerait l'état de transition réel
00:23:55.06 vous avez l'eau nucléophile et vous avez l'état de transition
00:23:58.29 où ils sont liés au phosphate gamma
00:24:00.25 et la glutamine fixe l'eau par rapport au phosphate
00:24:05.07 par un accepteur et une interaction avec un donneur de liaison hydrogène.
00:24:09.17 Et l'arginine (ce qu'on appelle le doigt d'arginine) est d'abord stabilisante
00:24:13.29 la position de cette glutamine et elle délivre également cette charge positive
00:24:18.03 du groupe amino pour neutraliser les charges dans le gamma phosphate.
00:24:22.28 Ce sont donc les deux résidus qui sont vraiment cruciaux pour la réaction
00:24:27.08 glutamine 61 de Ras et le doigt d'arginine de RasGAP.
00:24:32.05 Et cela explique déjà, par exemple, pourquoi les mutations de la glutamine 61 dans Ras oncogène
00:24:37.19 gâcher la réaction d'hydrolyse parce que vous pouvez imaginer si vous avez, par exemple,
00:24:42.09 une leucine ou autre ici, si on ne peut pas faire ce genre d'interactions ici.
00:24:47.00 Donc toute mutation de la glutamine 61 est oncogène car c'est un résidu catalytique direct.
00:24:53.16 Donc la structure explique aussi pourquoi les mutations de la glycine 12 sont oncogènes.
00:24:58.22 Et cela aussi peut être facilement vu ici sur cette diapositive.
00:25:02.04 Vous avez de la glycine 12 qui, une fois mutée en un résidu, en fait un oncogène.
00:25:06.25 Et puis vous voyez le fluorure d'aluminium être ce triangle plat.
00:25:11.08 Vous voyez la glutamine 61 être là et vous voyez le doigt d'arginine ici.
00:25:16.09 Et ils sont tous très très proches les uns des autres indiqués par ces lignes pointillées bleues
00: 25: 20.04 qui indiquent qu'il s'agit presque de la distance de VanDerWaals.
00:25:24.04 Et maintenant, si vous mute, par exemple, la glycine en le plus petit acide aminé possible,
00:25:28.11 ce serait de l'alanine, vous voyez que cela gâcherait immédiatement tous ces résidus dans le site actif.
00:25:34.01 Donc pour des raisons stériques, il ne peut y avoir aucun autre résidu
00:25:36.24 dans le site actif à l'état de transition sauf pour la glycine.
00:25:43.08 Donc le message de tout cela était, évidemment, qu'il y a une arginine
00:25:49.00 que nous appelons le doigt d'arginine qui appuie sur la gâchette de la réaction GTPase.
00:25:54.00 Sans cela, il est très lent et avec lui, il devient 10^5 fois plus rapide.
00:26:01.01 Nous avons également utilisé. revenons donc à la question : qu'est-ce qui limite maintenant le débit dans l'ensemble du processus ?
00:26:07.00 Ainsi, la principale étape régulatrice de l'hydrolyse intrinsèque du GTP est l'étape chimique très lente, l'hydrolyse lente.
00:26:14.29 Mais en utilisant une technique différente, nous découvrons maintenant que
00:26:17.25 il y a une autre étape qui devient partiellement la limitation du débit et je vais vous le montrer dans une minute.
00:26:23.29 Nous utilisons donc la spectroscopie infrarouge à transformée de Fourier à résolution temporelle.
00:26:28.10 Et avec cela, nous pouvons faire une résolution presque atomique.
00:26:33.11 Nous pouvons observer les atomes du site actif sur une échelle de temps de la milliseconde.
00:26:37.27 Donc, si vous voyez un spectre infrarouge d'une protéine, qui a des bandes amide I et amide II,
00:26:47.20 qui n'est pas une information très structurée car c'est un mélange d'informations sur
00:26:54.26 des hélices alpha, des feuilles bêta et ainsi de suite et pas beaucoup de détails peuvent être tirés d'une telle image.
00:27:02.26 Mais ce que nous faisons, c'est observer, pour une réaction. disons qu'une protéine va de A à B
00:27:09.05 nous observons les différents spectres qui au moins sur cette échelle d'absorption
00:27:16.19 ne montre pas beaucoup de différence mais si vous regardez plus en détail.
00:27:20.15 donc vous voyez que l'absorption est de 0,0 et l'absorption ici est de 0,02,
00:27:25.14 donc nous voyons des changements très petits mais très reproductibles
00:27:29.21 au cours de la réaction quand A va vers B.
00:27:33.02 Et nous voyons des pics négatifs qui signifient que A s'en va et nous voyons des pics positifs si B monte.
00:27:40.22 Ainsi, nous pouvons observer les choses qui se perdent et celles qui remontent
00:27:43.29 au cours de la réaction et nous pouvons les suivre par FTIR.
00:27:49.25 Et si vous le faites. donc tout d'abord nous devons déclencher la réaction à un moment donné
00:27:56.25 afin d'observer les changements structurels de la seconde échelle de temps.
00:28:03.04 Et pour ce faire, nous utilisons, encore une fois, un autre analogique
00: 28: 07.00 et les différents analogues sont en cage GTP qui a été développé par Roger Goody
00:28:10.22 qui est un de mes collègues à l'Institut.
00:28:14.05 Et ce GTP en cage est bloqué sur le phosphate gamma par ce qu'on appelle le groupe cage.
00: 28: 20.22 Donc ça ne permet pas l'hydrolyse mais maintenant, avec un flash de lumière, tu peux séparer ce groupe de cages
00:28:26.21 et maintenant vous avez Ras-GTP qui peut ensuite s'hydrolyser en GDP et Pi.
00:28:31.19 Si vous faites cela avec disons Ras sans GAP,
00:28:39.11 ce que vous voyez, c'est que vous avez un. par exemple, vous voyez l'absorbance.
00:28:44.22 donc toute absorbance que vous pourriez connaître à partir de l'infrarouge, montre une vibration atomique dans les liaisons.
00:28:51.09 Par exemple, vous voyez des vibrations pour le
00:28:53.15 alpha, le bêta, le gamma, qui diminuent vers la fin et deviennent nuls au bout de 2 heures, 5 minutes.
00:29:00.29 Donc le spectre de différence (soustrayez le spectre final du spectre de départ)
00:29:06.16 et vous ne voyez alors que les changements qui se produisent pendant la réaction.
00:29:11.23 Et c'est tout à fait normal. Il y a une seule décroissance exponentielle lorsque Ras hydrolyse le GTP.
00:29:18.21 Pas grave.
00:29:20.15 Mais ce qui est intéressant, c'est que lorsque vous analysez la réaction médiée par GAP
00:29:24.26 parce que maintenant vous ne voyez pas une seule décroissance exponentielle, mais vous voyez soudainement des intermédiaires apparaître.
00:29:30.14 Vous voyez des pics qui montent et descendent et le plus important est
00:29:35.04 indiqué par ce numéro 1113. C'est la fréquence de ce changement particulier.
00:29:39.28 Vous devez évidemment analyser ce que fait chaque groupe, à quoi appartient-il.
00:29:47.06 Alors ce que nous faisons dans l'ordre. nous avons développé ces techniques
00:29:52.17 ou nos collègues de l'Université de Bochum avec qui nous collaborons
00:29:56.03 ils ont développé des techniques pour découvrir quelle est chaque bande passante,
00:30:01.01 quelle est chaque fréquence. changement d'absorbance. à quoi est-ce dû.
00:30:03.28 Par exemple, vous trouvez pour GTP qu'il y a un changement d'absorbance à venir
00:30:10.13 une constante de vitesse k2. Donc k1 est la photoisomérisation, k2 est une réaction et k3 est la suivante.
00:30:17.18 Et si vous faites cela, vous obtenez une augmentation et une diminution avec k3.
00:30:21.12 Et puis il y a un intermédiaire qui arrive à 11h13.
00:30:26.12 Il arrive avec k2 et se désintègre avec k3.
00:30:30.01 Il y a Pi gratuit avec k3. De tout cela, on peut évidemment conclure
00:30:35.18 qu'il y a un intermédiaire Pi avec cette fréquence d'absorption ici, 1113 cm^-1
00:30:44.02 qui apparaît avec la constante de vitesse k2 et décroît avec une constante de vitesse k3.
00:30:50.03 Donc, en d'autres termes, la sortie de Pi devient maintenant visible.
00:30:54.25 Nous voyons donc une hydrolyse lorsque ce pic Pi apparaît.
00:30:58.21 Et nous voyons la décomposition quand elle disparaît.
00:31:01.01 Et vous voyez ceci ici, par exemple, en temps réel.
00:31:03.25 Donc l'absorption change avec la constante de vitesse k2. vous voyez le schéma ici :
00: 31: 09.05 Ras quand il est à l'état activé passe à l'état Pi et vous voyez qu'il y a un Pi lié à une protéine
00:31:17.13 qui monte et la bande Pi descend au cours de la réaction.
00:31:21.20 Et cela se répète un certain nombre de fois.
00:31:23.07 Et vous aussi pour qu'il y ait un doigt d'arginine qui entre et sort de la chambre de réaction.
00:31:30.00 Nous pouvons donc suivre non seulement les bandes de protéines,
00:31:32.16, nous pouvons suivre les bandes de phosphate à une résolution atomique sur une échelle de temps d'une milliseconde.
00:31:40.26 Et cela nous dit maintenant, tous ensemble, que c'est le message de tout cela,
00: 31: 46.01 que même si vous avez une énergie d'activation élevée pour la réaction d'hydrolyse intrinsèque de 92 kJ/mol
00:31:54.01 vous séparez maintenant la réaction en deux réactions partielles,
00:31:57.16 qui ont une énergie d'activation plus faible et c'est pourquoi cela le rend tellement plus rapide.
00:32:01.08 Vous avez donc la première énergie d'activation pour la réaction de clivage. ce qui conduit à Ras-GDP-Pi.
00:32:08.03 Et vous avez la deuxième étape où vous avez la sortie de Pi et maintenant vous avez le produit.
00:32:12.14 C'est donc, encore une fois, un thème général de l'enzymologie
00: 32: 15.12 qu'une réaction catalysée par une enzyme abaisse l'énergie d'activation
00:32:20.00 non seulement en abaissant une réaction mais aussi en la subdivisant en étapes partielles
00:32:24.28 dont chacun a une énergie d'activation différente.
00:32:29.22 Et ici vous voyez que cette énergie d'activation est de 59 kcal/mol et 66 ce qui signifie
00:32:36.04 que c'est un peu plus élevé et c'est pourquoi c'est l'étape partiellement limitante de la réaction globale.
00:32:45.12 Alors laissez-moi vous donner maintenant. c'était donc Ras et comment cela conduit à la formation de tumeurs
00:32:50.14 et nous avons analysé en détail comment cela fonctionnait même au niveau biophysique
00:32:55.02 mais permettez-moi maintenant de revenir sur pourquoi certaines réactions GTPase, quand elles ne fonctionnent pas,
00:33:03.00 comment ils conduisent à différents types de maladies.
00:33:05.20 La neurofibromatose en fait partie.
00:33:07.27 Je vous ai déjà montré que la neurofibromine, le produit génique du gène est un Ras GAP.
00:33:15.09 Et il existe une maladie appelée neurofibromatose de type I. C'est ce que les gens ont des taches de café au lait sur la peau,
00:33:22.21 parfois de petites tumeurs sur la peau qui peuvent parfois être assez grosses et très défigurantes
00:33:28.16 qui sont causées par une mutation ou une délétion du gène de la neurofibromatose.
00:33:35.21 Et par exemple, lorsque nous avons travaillé sur le mécanisme d'hydrolyse du GTP, par GAP et NF1,
00:33:43.00 un collègue de la Charite Clinic à Berlin est venu nous voir et nous a dit qu'il avait
00:33:48.03 une patiente qui décède à l'âge de 35 ans et elle a trois fils indiqués là-haut
00:33:55.20 qui ont aussi la maladie. Et il a analysé le sang du patient puis la tumeur elle-même.
00:34:04.22 Il a découvert qu'il y a une mutation dans la séquence de la neurofibrobromine
00:34:11.29 où l'arginine est mutée en proline. Vous voyez que là-bas, l'arginine est mutée en proline.
00:34:17.13 Et évidemment, je ne vous dirais pas ça, si ce n'était l'arginine catalytique.
00:34:21.19 Il s'avère qu'ils ont une mutation dans l'arginine catalytique
00:34:25.23 et quand vous faites maintenant la réaction GTPase que je vous ai déjà montrée,
00:34:30.09 vous voyez que vous avez, avec NF1 normal vous avez la courbe bleue ici,
00: 34: 37.17 cela signifie une augmentation de la fluorescence et une diminution avec l'hydrolyse
00:34:43.03 et maintenant si vous prenez cette mutation, R à P, vous avez une augmentation ce qui signifie une formation complexe
00:34:48.03 mais pas d'hydrolyse et il y a un autre patient que nous avons analysé entre-temps
00: 34: 53.16 encore une fois de l'arginine à autre chose, Q dans ce cas particulier,
00: 34: 58.09 conduit à un blocage de sa capacité à hydrolyser le GTP sur Ras.
00:35:02.17 Ainsi, la mutation de l'arginine essentielle conduit à la maladie neurofibromatose.
00:35:08.16 De plus, je dois souligner qu'il existe de nombreuses autres mutations dans la neurofibromine
00:35:13.22 qui provoquent également la maladie qui est phénotypiquement très différente chez de nombreux patients différents.
00:35:20.26 Permettez-moi de vous présenter maintenant un système différent qui est
00:35:24.06 intéressant à la fois d'un point de vue biochimique mais aussi d'un point de vue d'une autre maladie
00:35:29.11 auquel je reviendrai en temps voulu.
00:35:33.03 Je vais donc parler d'une molécule appelée Rap qui, de toute évidence, a un RasGAP apparenté.
00:35:40.16 Et Rap est un proche homologue de Ras et le nom dérive de
00:35:44.05 le fait qu'il est hautement homologue à Ras parce que Rap signifie Ras Proximate.
00:35:49.07 Même s'il était considéré comme un proche homologue de Ras, il fait quelque chose de complètement différent.
00:35:55.14 Il a évidemment le même cycle entre le PIB et le GTP. Cela fonctionne donc comme un interrupteur moléculaire.
00:36:02.00 Mais cela n'a pas à voir avec la prolifération, comme Ras, ou la différenciation, mais plutôt
00:36:06.10 il est impliqué dans l'activation des intégrines, ou l'activation des plaquettes ou d'autres choses.
00:36:11.19 La biologie du rap est donc complètement différente.
00:36:14.17 Pourquoi la biochimie est si intéressante, c'est que Rap est le seul homologue
00: 36: 22.12 ou le seul membre de la super famille Ras qui n'a pas de glutamine dans la position
00: 36: 27.18 où la glutamine 61 de Ras est impliquée dans l'hydrolyse du GTP.
00:36:33.01 Donc, il manque le résidu que nous pensions être l'hydrolyse GTP absolument cruciale et ici, ce n'est pas là.
00:36:39.18 Et, évidemment, la question est de savoir pourquoi et comment RapGAP
00:36:42.25 puis travaillez sur ce système et comment il stimule la réaction.
00:36:48.29 Alors tout d'abord, permettez-moi de vous présenter les RapGAP.
00:36:52.24 Il en est indiqué ici cinq mais il y en a plus dans le génome humain
00:36:57.23 mais ces cinq RapGAP contiennent tous un domaine hautement homologue
00:37:04.02 qui est indiqué ici par la coloration bleu clair et bleu foncé
00:37:08.09 où le bleu clair est quelque peu différent du bleu foncé.
00:37:12.05 Et j'expliquerai cela lorsque nous examinerons la structure.
00:37:13.21 Encore une fois, l'organisation du domaine de ces cinq RapGAP est quelque peu différente.
00:37:17.25 Cela signifie qu'ils font probablement leur travail dans un contexte biologique différent.
00:37:23.04 La raison pour laquelle c'est également intéressant est que la région d'homologie bleu foncé est
00:37:28.10 également conservé dans une protéine appelée Tuberine
00:37:30.17 qui représente une maladie dont je parlerai à la fin.
00:37:34.03 C'est pourquoi il était également intéressant d'examiner cette réaction.
00:37:37.06 Et la troisième raison pour laquelle il est intéressant de regarder cette réaction est indiquée dans la diapositive suivante.
00:37:42.19 Mais avant de faire cela, laissez-moi vous montrer tout d'abord que nous faisons, encore une fois, un test de fluorescence à flux arrêté.
00:37:48.23 Nous avons développé un système où nous pouvons regarder cette réaction d'une manière biochimique
00:37:53.12 et analyser les mutations et la vitesse de réaction et ainsi de suite.
00:37:58.13 Ici encore, Rap-GTP interagit avec RapGAP
00:38:03.20 Vous obtenez une augmentation importante et rapide de la fluorescence due à une formation complexe
00:38:07.28 et une diminution due à l'hydrolyse du GTP et à la dissociation du produit.
00:38:12.25 Et tout est fini, encore une fois, après une seconde.
00:38:16.03 alors que sans RapGAP, toute la réaction prendrait des heures.
00:38:19.25 Donc, en d'autres termes, nous avons à nouveau une stimulation de 10^5 de la réaction.
00:38:23.15 Mais la raison pour laquelle c'est aussi un système intéressant du point de vue biochimique et mécanique,
00: 38: 29.09 est qu'il y a un certain nombre d'arginines conservées dans RapGAP et évidemment
00:38:35.00 nous pensions que l'un d'entre eux serait impliqué dans la fourniture d'un doigt d'arginine au système.
00:38:39.06 En fait, nous les avons tous mutés en alanine
00:38:42.06 et aucun d'entre eux n'a d'effet dramatique sur l'activité comme on peut le voir ici.
00:38:48.02 Donc la pire réaction est toujours proche de 0,5/seconde.
00:38:52.02 Donc, en d'autres termes, il n'y a pas d'effet dramatique lorsque vous faites muter l'une des arginines
00:38:55.29 ce qui rend peu probable qu'il y ait un doigt d'arginine impliqué dans la réaction.
00:39:00.23 Donc les deux résidus, la glutamine intrinsèque et le doigt d'arginine en trans
00:39:09.04 qui est Ras et Rho et d'autres font la catalyse importante ne sont pas ici dans ce système.
00:39:17.05 Cela signifie que toute la chimie doit être totalement différente.
00:39:21.15 Nous avons donc examiné à nouveau le FTIR du système et
00:39:26.07 il montre fondamentalement les mêmes caractéristiques même si leurs structures sont quelque peu différentes.
00:39:31.16 Les caractéristiques de base sont qu'il existe un intermédiaire Pi dont la diminution limite le débit
00: 39: 37.23 pour la réaction et bien que ce soit chimiquement quelque peu différent,
00:39:41.27 comme le montrent les différents spectres d'absorption, c'est, en effet, cinétiquement un intermédiaire le plus important.
00:39:50.11 Mais ce qui était intéressant, et nous avons trouvé dans ce cas particulier, dans l'affaire RapGAP,
00: 39: 56.10 et il a également été trouvé dans d'autres systèmes entre-temps,
00: 39: 58.27 est que la réaction GTPase est réversible,
00:40:01.29 ce qui semble un peu fou parce que c'est une réaction descendante.
00:40:05.06 Si vous prenez GDP et Pi et l'ensemble du système, vous ne créerez jamais de GTP.
00:40:09.22 Mais ce qui se passe, c'est que si vous analysez la réaction en
00:40:13.05 en utilisant, au lieu de l'eau normale, de l'eau O18, qui est indiquée par ce point noir,
00: 40: 17.23 vous vous attendriez à ce que dans la réaction, vous obteniez une hydrolyse, puis vous obteniez GDP et Pi
00: 40: 23.27 qui a un phosphate étiqueté comme oxygène O18 plutôt, un oxygène étiqueté comme oxygène O18.
00:40:30.12 Mais au lieu d'obtenir un Pi avec un oxygène O18, vous obtenez un Pi avec deux oxygènes O18,
00: 40: 36.24 avec trois oxygènes O18, et avec quatre oxygènes O18 comme analysé ici par une spec de masse.
00:40:42.11 Vous voyez où vous obtenez ces quatre produits, analysés par spectroscopie de masse.
00:40:49.27 Alors, comment cela se passe-t-il ?
00:40:51.09 Donc cela arrive parce que sur la protéine vous avez cet intermédiaire de longue durée
00: 40: 56.00 avec GDP et Pi, assis dans le site actif avant d'entrer dans le produit qui peut également
00:41:03.10 faire une réaction en retour pour faire du GTP avec un oxygène maintenant sur le gamma phosphate.
00:41:08.15 Maintenant, s'il réagit à nouveau avec de l'eau O18, vous obtenez l'incorporation d'un deuxième O18 dans le produit.
00:41:15.27 Et si cela se reproduit, un troisième et un quatrième.
00:41:18.16 Ainsi, bien que la réaction globale soit en baisse,
00:41:22.12 sur l'enzyme, vous obtenez une réaction inverse.
00:41:24.15 Et vous ne pourrez jamais l'obtenir une fois Pi sorti
00:41:28.21 parce que l'énergie d'activation pour la réaction inverse est trop élevée.
00:41:33.18 Nous avons donc également résolu la structure de RapGAP.
00:41:37.06 Il s'agit d'une structure à deux domaines où un domaine, que vous voyez maintenant à gauche,
00: 41: 44.07 est le domaine catalytique - la région bleu foncé dans le diagramme d'homologie que je vous ai montré
00: 41: 49.01 et le bleu clair est le domaine de dimérisation qui n'est pas important pour la catalyse
00:41:53.08 mais est là pour dimériser la protéine
00:41:56.18 pour une raison que nous ne connaissons vraiment pas.
00:42:00.13 Donc, en analysant le domaine catalytique, évidemment, vous vous demandez :
00:42:03.10 Quels sont les résidus conservés et lesquels jouent un rôle important dans la catalyse ?
00:42:08.04 L'hélice violette que j'ai indiquée ici est la région la mieux conservée.
00:42:12.00 Il est donc probable que des résidus sur cette hélice soient impliqués d'une manière ou d'une autre dans la catalyse.
00:42:18.05 Et en effet, vous pouvez muter beaucoup d'entre eux et vous voyez certains effets.
00:42:21.12 Mais l'effet le plus dramatique se produit lorsque vous mute
00:42:25.01 N290, donc une asparagine, assise sur cette hélice catalytique.
00:42:29.08 Lorsque vous modifiez cela, vous obtenez le résultat suivant.
00:42:33.00 Donc nous l'appelons, au fait, le Asn-Thumb pour faire la différence avec le Doigt d'Arginine.
00:42:39.03 C'est donc un Asn-Thumb et vous verrez dans une minute pourquoi nous l'appelons Asn-Thumb.
00:42:44.26 Donc, tout d'abord, si vous regardez maintenant la mutation dont j'ai parlé,
00:42:48.27 donc si vous prenez la mutation N290A et analysez la réaction, encore une fois,
00:42:55.09 ce test fluorescent à flux arrêté, vous voyez que tandis que le type sauvage fait un complexe
00:43:00.25 puis se désintègre en produit,
00:43:02.26 la mutation ici fait un complexe, c'est même, d'ailleurs, plus serré que dans le cas de type sauvage,
00:43:09.15 mais il n'y a absolument pas d'hydrolyse.
00:43:11.07 La réaction continue encore et encore. Il reste là-haut et ne descend jamais.
00:43:14.21 Alors que si vous faites une mutation comme H287 en alanine,
00:43:20.22 vous voyez qu'il n'y a pas de formation complexe parce que la fluorescence reste ici.
00:43:24.04 Donc cette réaction est morte car elle ne peut pas se lier
00:43:27.08 mais la réaction rouge est bonne car nous pensons que c'est le résidu catalytique important.
00:43:32.12 Nous pensons cela en regardant simplement la biochimie.
00:43:35.15 Évidemment, pour savoir ce qu'il fait, nous devons à nouveau résoudre la structure,
00:43:38.26 ce que nous avons fait. C'est le complexe Rap-RapGAP.
00:43:43.15 Et vous voyez ici le rouge et le vert c'est RapGAP et le bleu c'est le Rap.
00:43:49.20 Et vous voyez GTP. Mais ce que vous voyez aussi si vous le regardez en détail,
00: 43: 54.02 est qu'il y a, encore une fois, quelque chose qui pointe du domaine catalytique rouge de RapGAP
00:43:59.06 dans le site actif et c'est une asparagine.
00:44:01.17 Évidemment, c'est l'asparagine dont j'ai parlé.
00:44:04.20 qui pénètre dans le site actif du Rap. C'est pourquoi nous l'appelons l'Asn-Pouce
00:44:08.28 par rapport à l'Arginine Finger dans les autres systèmes.
00:44:12.27 Et si vous regardez en détail ce qui se passe sur le site actif,
00:44:17.02 et si vous le comparez à trois autres structures de la protéine Ras et à leurs GAP apparentés,
00:44:26.19 prenant Ran et RanGAP, Ras et RasGAP, et Rho et RhoGAP,
00:44:31.18 où Rho et RhoGAP proviennent de Rittinger et al. et les autres structures sont de nous,
00:44:35.14 vous voyez que les trois autres, ces trois structures ici,
00:44:40.12 ont une glutamine pointant vers l'eau catalytique,
00:44:44.29 qui attaque le gamma phosphate indiqué ici,
00:44:47.09 qui est le fluorure d'aluminium,
00:44:50.01 un état de transition qui imite le phosphate gamma qui est transféré.
00:44:54.08 Et la structure rouge ici a, au lieu de la glutamine 61, une thréonine
00:45:00.19 qui pointe loin du site actif n'a rien à voir avec la catalyse.
00:45:04.01 Au lieu de cela, ce que vous voyez, c'est que l'hélice violette insère ici cette asparagine
00:45:09.19 dans le site actif exactement à l'endroit où les autres ont la glutamine.
00:45:14.23 Donc les différences ici : les trois autres structures ont une glutamine, qui est en cis
00:45:19.29 et Rap et RapGAP ont une asparagine en trans
00:45:23.17 qui fait la même chose à savoir, stabiliser l'eau catalytique.
00:45:30.04 Et si vous regardez la surface de la protéine,
00:45:34.01 c'est la surface Rap montrée comme une représentation de surface,
00:45:39.07 et à cela s'ajoute l'hélice de RapGAP.
00:45:43.09 Il repose sur la surface et insère cette asparagine dans le site actif.
00:45:48.13 Donc le phosphate gamma atteint un pic hors de ce trou.
00:45:50.08 Et tout ce que RapGAP fait vraiment, c'est qu'il a sur l'hélice cet Asn, il le met dans le site actif,
00:45:57.17 et cela seul semble être, au moins dans un sens chimique,
00:46:03.03 responsable de la stimulation de la réaction GTPase par 10^5 fois
00:46:07.10 parce que si vous faites muter cette chose, elle se lie toujours bien, mais il n'y a absolument pas d'hydrolyse.
00:46:11.22 Cela nous fait donc réfléchir, encore une fois, à l'avenir de la conception de médicaments anti-Ras.
00:46:18.02 S'il suffit d'insérer un tel résidu dans le site actif,
00:46:22.11 d'un point de vue chimique, cela devrait être faisable,
00:46:24.24 mais nous devons évidemment développer des molécules qui se lient de manière correcte
00:46:28.12 sur la surface, ce qui n'est pas si facile et nous pensons toujours que nous pourrions le faire.
00:46:35.15 C'est, encore une fois, d'y revenir.
00:46:38.00 Donc, comme approche de la cible des médicaments anticancéreux,
00:46:42.03 trouvons des molécules qui induisent l'hydrolyse du Ras oncogène.
00:46:46.20 Et d'après ce que nous avons observé avec RapGAP, nous avons l'espoir que cela puisse être fait.
00:46:54.26 Et la troisième raison pour laquelle travailler avec le système Rap-RapGAP est que
00:47:03.05 c'est lié à une maladie appelée sclérose tubéreuse, une tumeur bénigne.
00:47:06.19 Les gens arrivent avec des hamartomes dans de nombreux organes.
00:47:09.16 Mais la caractéristique la plus évidente et d'où vient le nom est que
00:47:14.07 les gens ont, quand ils font une RMN du cerveau, ils ont
00:47:16.29 ces sortes de choses sclérosées et tubéreuses dans le cerveau que vous voyez dans la RMN du cerveau.
00:47:24.17 Les gens ont une mutation dans deux protéines appelées Tuberine et Hamartin.
00:47:30.22 Et Tuberin, comme je vous l'ai déjà montré, a une forte homologie
00:47:34.22 à RapGAP dans cette région bleu foncé, cela signifie la région catalytique.
00:47:39.07 Et si vous regardez maintenant, par exemple, où les mutations des patients dans la sclérose tubéreuse,
00:47:44.23 à Tuberin, où ils se produisent.
00:47:47.00 Et c'est un alignement de différentes séquences RapGAP et elles s'alignent avec la séquence Tuberin.
00:47:53.27 Vous voyez que la région la plus hautement conservée est, encore une fois,
00:47:57.09 cette chose ici (le truc rouge) où vous avez l'hélice catalytique.
00:48:01.08 Et l'une des mutations chez un patient atteint de sclérose tubéreuse de Bourneville
00:48:04.22 (et beaucoup ont en fait cette mutation) est activé
00:48:07.06 cette asparagine que nous connaissons est le résidu catalytique important.
00:48:11.08 C'est donc une autre version de ce que nous avons vu auparavant
00:48:14.21 un important résidu catalytique est muté dans la maladie de la sclérose tubéreuse de Bourneville.
00:48:21.19 Alors permettez-moi, dans les cinq dernières minutes, de vous donner une autre maladie,
00:48:25.22 juste pour s'assurer qu'il n'y a pas que le système Ras et Rap,
00:48:28.28 qu'il existe de nombreuses maladies où l'incapacité à hydrolyser le GTP conduit à de très nombreuses maladies différentes.
00:48:35.07 C'est donc la rétinite pigmentaire.
00:48:38.28 Les gens ont des pigments sur la rétine. C'est de là que vient le nom.
00:48:42.28 Et ils perdent la vision, ils perdent la vision périphérique.
00:48:47.00 C'est donc une personne normale qui voit ce bâtiment et c'est un patient atteint de la maladie
00:48:52.15 qui perd de plus en plus, progressivement, sa vision périphérique.
00:48:56.00 Et puis perd une vision complète après le développement complet de la maladie.
00: 49: 01.19 Et il y a un certain nombre de gènes mutés dans la rétinite pigmentaire
00:49:06.12 qui s'appellent RP12x et peu importe.
00:49:09.28 Et il existe une forme qui s'appelle RP2.
00:49:13.03 C'est une maladie liée à l'X où les gens ont des mutations dans beaucoup de mutations ponctuelles dans une protéine.
00:49:21.16 Nous avons déterminé la structure de la protéine, qui ressemble à ceci.
00:49:24.24 Ceci est un domaine en hélice bêta, et ceci est un autre domaine.
00:49:27.20 Et vous voyez beaucoup de mutations que vous analysez ensuite.
00:49:31.06 Vous découvrez que ce que vous voyez, c'est que la plupart des mutations
00:49:37.16 déterminer ou gâcher, probablement, la structure parce qu'ils sont à l'intérieur
00:49:41.24 le noyau hydrophobe de la protéine et vous imagineriez que
00:49:45.04 ils ne font rien pour la catalyse ou l'interaction de cette protéine.
00:49:50.19 Mais il y a quelques mutations, indiquées ici, par exemple,
00:49:54.01 E138G ou R118 à H, K ou C. Donc, ces résidus pointent vers la solution.
00:50:03.27 Donc on pourrait penser qu'ils font quelque chose d'important pour l'interaction de la protéine
00:50:08.20 ou dans quelque chose - qu'ils sont impliqués dans ce que ces protéines font normalement.
00:50:14.20 Nous avons donc résolu, encore une fois, la structure du complexe entre Arl3.
00:50:19.13 Nous savions donc que RP2 interagissait avec Arl3, une autre protéine de type Ras.
00:50:24.26 Elle s'appelle Arl parce que c'est une protéine apparentée à l'Arf.
00:50:28.04 Et nous avons résolu la structure de cela. Donc, vous voyez que ce truc ici serait le RP2 en violet.
00:50:37.25 Et vous voyez en vert serait Arl3 sous une forme liée au GTP.
00:50:41.25 Et ce que vous voyez alors, si vous regardez encore de très près,
00:50:44.26 vous voyez qu'il y a un résidu de RP2, juste ici, qui pointe vers le site actif de l'Arl.
00:50:52.10 Donc on ne savait pas ce que faisait RP2, mais quand nous avons résolu la structure,
00:50:55.17 nous avons pu voir immédiatement que ça sent le GAP parce que
00: 50: 59.18 il met un doigt d'arginine dans le site actif de l'autre protéine.
00:51:05.08 Et si vous regardez le site actif en détail, vous voyez que ce serait le PIB, encore une fois,
00:51:10.28 c'est du fluorure d'aluminium, c'est de la glutamine d'Arl3,
00:51:15.14 et ce sont trois résidus de RP2--Q116, R118, E138.
00:51:21.26 Et, évidemment, tous ces résidus sont mutés dans la rétinite pigmentaire.
00:51:27.15 Et vous pouvez voir que l'arginine fait la même chose que vous avez déjà vue plusieurs fois auparavant.
00:51:32.22 Et il est stabilisé par ces autres résidus et les trois résidus, une fois mutés,
00:51:38.10 gâcher l'activité GAP de RP2.
00:51:41.26 Donc ici, la structure nous a vraiment dit ce que fait la protéine.
00:51:44.19 Il n'y avait aucune idée de la fonction et la structure nous a dit, exactement, qu'il s'agit d'un GAP pour Arl3.
00:51:53.17 Permettez-moi maintenant de tirer les conclusions de ce dont je vous ai parlé.
00:52:00.12 Tout d'abord, peut-être, des conclusions sur Ras lui-même parce que c'est l'oncogène le plus important.
00:52:06.14 C'est une enzyme incomplète, elle ne peut pas hydrolyser le GTP très rapidement.
00:52:11.09 Mais vient ensuite RasGAP qui stabilise le switch II et la glutamine 61,
00:52:16.10 qui est l'élément catalytique structurel important et il fournit également un doigt d'arginine dans le site actif.
00:52:23.04 Vous avez une mutation Gln1 - toute mutation de la glutamine 61 est un oncogène
00:52:28.29 car il manque donc le résidu catalytique (le système).
00:52:33.00 Vous avez des mutants de glycine qui sont stériquement compromis pour faire l'hydrolyse du GTP.
00:52:38.21 Il n'y a aucun moyen que le doigt d'arginine
00:52:42.06 peut entrer dans sa position correcte lorsqu'il y a une mutation de la glycine 12.
00:52:46.04 Je vous ai également montré qu'il existe un intermédiaire GDP-Pi fortement lié.
00:52:50.02 Et cette version Pi dans le système devient limitante.
00:52:54.28 Alors que sans GAP, la réaction de clivage chimique est l'étape limitant la vitesse.
00:53:00.23 La deuxième conclusion - plus générale pour la superfamille Ras.
00:53:05.01 Les protéines Ras sont toutes des enzymes incomplètes.
00:53:07.20 Ils hydrolysent tous le GTP très, très lentement.
00:53:09.27 Ils ont des GAP apparentés.
00:53:12.02 Donc chacune des protéines de sous-famille et parfois même des protéines au sein de la sous-famille,
00:53:16.24 ont un GAP apparenté spécifique qui est requis pour l'hydrolyse rapide du GTP, pour la catalyse.
00:53:22.17 Certains GAP fournissent un doigt d'arginine
00:53:25.02 et je vous ai maintenant montré de nombreux exemples différents - Ras et Ran et Rho.
00:53:30.15 Les RabGAP délivrent une agrinine et un Gln.
00:53:34.23 Certains GAP fournissent un pouce Asn.
00:53:37.00 Je vous ai montré l'exemple de RapGAP et Tuberin fait probablement la même chose.
00:53:41.03 La version Pi est très souvent limitante.
00:53:44.10 Et ce qui est encore plus important, et c'est mon message pour tout le discours,
00: 53: 47.19 est que la réaction GTPase perturbée est impliquée dans un certain nombre de maladies :
00:53:53.24 cancer, neurofibromatose, sclérose tubéreuse,
00:53:58.03 rétinite pigmentaire et bien d'autres dont je n'ai pas parlé.
00:54:01.07 Merci de votre attention. Mais je voudrais.
00:54:03.00 Avant de m'arrêter, permettez-moi d'abord de remercier les personnes qui ont fait le travail.
00:54:07.18 La plus ancienne histoire dont je vous ai parlé est celle de Ras et RasGAP,
00:54:11.22 qui a été fait par trois post-doctorants du laboratoire, Reza Ahmadian, Klaus Scheffzek et Robert Mittal.
00:54:17.23 L'histoire RapGAP a été réalisée par les étudiants Oli Daumke, Astrid Kramer,
00:54:23.14 Partha Chakrabarti et Andrea Scrima.
00:54:26.18 Et l'histoire de RP2 a été réalisée par Stefan Veltel et Karin Kuhnel.
00:54:32.04 Et beaucoup de films que je vous ai montrés sont réalisés par Ingrid Vetter
00:54:36.20 qui dirige aussi mon laboratoire de cristallographie.
00:54:38.15 Et elle a été très, très utile dans presque tous les projets.
00:54:42.13 Et nous l'avons fait. sur le FTIR, nous avons des collaborations avec
00:54:46.03 nos collègues de l'Université de Bochum qui sont Klaus Gerwert et Carsten Kotting.
00:54:51.03 Merci de votre attention.
00:54:52.10

  • Partie 1 : Protéines liant le GTP en tant que commutateurs moléculaires

Pourquoi la nature a choisi le phosphate pour modifier les protéines

Les propriétés chimiques avantageuses de la liaison ester phosphate ont été exploitées au début de l'évolution pour générer les liaisons diester phosphate qui relient les bases voisines dans l'ARN et l'ADN (Westheimer 1987 Science235, 1173-1178). Suite à la fixation du code génétique, une autre utilisation pour la modification des esters phosphates a été trouvée, à savoir la phosphorylation réversible des trois acides aminés hydroxylés, la sérine, la thréonine et la tyrosine, dans les protéines. Au cours de l'évolution, la phosphorylation a émergé comme l'un des types les plus importants de modification post-traductionnelle, en raison de sa polyvalence et de sa réversibilité immédiate. Les phosphoaminoacides générés par la phosphorylation des protéines agissent comme Nouveau des entités chimiques qui ne ressemblent à aucun acide aminé naturel, et permettent ainsi de diversifier la nature chimique des surfaces protéiques. Un groupe phosphate lié à une protéine peut former des liaisons hydrogène ou des ponts salins intra- ou intermoléculaires, créant des liaisons hydrogène plus fortes avec l'arginine que l'aspartate ou le glutamate. La taille unique de l'enveloppe ionique et les propriétés de charge du phosphate lié de manière covalente permettent une reconnaissance spécifique et inductible des phosphoprotéines par des domaines de liaison phosphospécifiques dans d'autres protéines, favorisant ainsi l'interaction protéine-protéine inductible. De cette manière, la phosphorylation sert de commutateur qui permet aux réseaux de transduction de signaux de transmettre des signaux en réponse à des stimuli extracellulaires.

1. Les esters phosphates ont des propriétés chimiques avantageuses pour l'évolution de la vie

Les molécules contenant du phosphate sont des constituants essentiels de toutes les cellules vivantes. Quelles sont alors les propriétés spéciales du phosphate qui ont conduit à sa sélection en tant que bloc de construction clé au cours de l'évolution des formes de vie auto-répliquantes ? Le phosphore est un élément du groupe 15 et a donc cinq électrons dans sa couche externe. En faisant don de ses électrons, le phosphore peut former cinq liaisons covalentes par exemple, en se combinant avec quatre atomes d'oxygène, le phosphore forme l'orthophosphate, . Le phosphate a trois pKas (2,2, 7,2 (5,8 sous forme d'ester) et 12,4) et est très soluble dans l'eau, formant une grande coquille ionique hydratée. Le phosphate est chimiquement polyvalent et peut former des mono-, di- et triesters avec des groupes alkyle et aryle hydroxyle, ainsi que des anhydrides d'acide. De plus, le phosphore peut former des liaisons P-N (phosphoramidate), P-S (phosphorothioate) et P-C (phosphonate).

Les sels de phosphate sont très abondants sur Terre et, en raison de leur solubilité dans l'eau, étaient facilement disponibles au cours de l'évolution de la vie. La capacité du phosphate à former des esters et des anhydrides stables à température ambiante dans l'eau le rendait idéal pour la génération de molécules biologiques. Les esters et anhydrides de phosphate prédominent dans les organismes vivants, mais les phosphoramidates, les phosphorothioates et les phosphonates sont tous présents dans la nature. Les esters de phosphate sont facilement formés dans des conditions physiologiques en utilisant l'adénosine triphosphate (ATP), un anhydride de phosphate, comme donneur de phosphate et catalyseur enzymatique. Une fois formés, les esters de phosphate sont chimiquement stables en solution aqueuse à pH physiologique, et pourtant ils sont facilement hydrolysés par un catalyseur enzymatique approprié, régénérant ainsi le groupe OH d'origine et le phosphate libre. Dans les cellules, les esters phosphates importants comprennent les acides nucléiques et les phosphoprotéines. Des exemples d'anhydrides phosphates biologiques sont l'ATP et le PAPS (3'-phosphoadénosine-5'-phosphosulfate). Bien que le phosphate soit rarement utilisé comme groupe partant dans les synthèses chimiques, il est réactif aux températures physiologiques en présence de catalyseurs enzymatiques appropriés. Du fait de ses trois pKas, le phosphate est dianionique à pH 7, le pH physiologique intracellulaire. Ainsi, les groupes monoester phosphate ont une charge négative complète et une seconde charge négative, qui peut être une charge partielle ou complète selon le contexte chimique. Les diesters phosphates conservent une charge négative complète. Il est important de noter que lorsque deux nucléosides sont liés par un diester de phosphate, le phosphate est toujours entièrement ionisé (pKa < 1), fournissant une charge négative pour retenir les acides nucléiques dans les membranes phospholipidiques, et protégeant également la liaison ester de l'hydrolyse par une attaque par des nucléophiles anioniques , tel que OH-. Toute molécule avec un ester phosphate, y compris les protéines phosphorylées, possède ces mêmes attributs. L'énorme stabilité des esters phosphatés dans l'eau à pH 7 (on estime que les monoesters phosphatés ont une demi-vie de 10 12 ans à 25°C [1]) permet la formation de polynucléotides très longs qui sont remarquablement stables malgré le grand nombre de les liaisons ester phosphate, un attribut essentiel pour le stockage à long terme de l'information génétique.

2. L'énergétique des réactions de phosphorylation et de déphosphorylation

La génération prébiotique d'ATP et d'autres nucléosides triphosphates était la clé de la formation des polynucléotides et du codage de l'information génétique. La sélection de l'ATP comme principal composé de stockage d'énergie signifiait également la disponibilité immédiate de groupes phosphate activés pour le transfert à d'autres molécules. En raison de sa fonction de stockage d'énergie, l'ATP est très abondant dans les cellules avec des concentrations allant généralement de 2 à 4 mM. L'ATP est hautement soluble et relativement stable dans l'eau au pH et aux températures physiologiques, et pourtant stocke une énergie chimique importante dans ses liaisons anhydride phosphate α–β et β–γ, chacune ayant des énergies libres d'hydrolyse d'environ 8–12 kcal mol -1 , en fonction des conditions ioniques. Les liaisons anhydride α–β et β–γ peuvent être utilisées pour entraîner d'importantes réactions biologiques. Cependant, de telles réactions sont en principe réversibles dans de nombreuses situations, car les esters d'hydroxyphosphate d'alkyle et d'aryle ont également une énergie libre d'hydrolyse relativement élevée (environ 8 à 10 kcal mol -1 ). Les réactions impliquant le clivage de la liaison anhydride α–β, telles que la synthèse de polynucléotides, qui génèrent du pyrophosphate, sont rendues irréversibles grâce à l'abondante activité pyrophosphatase présente dans la plupart des cellules. Les réactions impliquant le clivage de la liaison anhydride β–γ, telles que la phosphorylation des protéines, sont rendues irréversibles en grande partie parce que les cellules maintiennent un rapport ATP/adénosine diphosphate (ADP) très élevé.

L'énergétique de la phosphorylation est relativement bien équilibrée, car l'énergie de la liaison ester phosphate est similaire à celle de la liaison anhydride ATP –γ. En fait, les constantes d'équilibre des protéines kinases pour la réaction (protéine + ATP → P.protéine + ADP) vont de 2 à 50, et de nombreuses protéines kinases fonctionneront facilement en sens inverse pour déphosphoryler une phosphoprotéine en présence d'ADP, générant de l'ATP [2 –4]. Ainsi, dans la cellule, la phosphorylation dépend du rapport ATP/ADP élevé, ce qui empêche la réaction inverse. Bien que les esters phosphates soient assez stables chimiquement, ils peuvent être facilement hydrolyses par un catalyseur enzymatique approprié dans des conditions physiologiques. L'énergie relativement élevée des monoesters de phosphate garantit qu'une fois hydrolysés, ils ne peuvent pas être reformés par phosphorolyse par réaction avec le phosphate libre, rendant ainsi la déphosphorylation irréversible.

3. L'évolution de la phosphorylation des protéines

Les propriétés chimiques avantageuses de la liaison ester phosphate ont été exploitées au début de l'évolution, comme en témoigne la liaison diester phosphate qui relie les bases voisines dans l'ARN et l'ADN [5]. Une fois le code génétique des 20 acides aminés communs fixé, une deuxième utilisation possible de la modification des esters phosphates est apparue, à savoir la phosphorylation des résidus sérine (Ser), thréonine (Thr) et tyrosine (Tyr) dans les protéines en tant que mécanisme régulateur. Au cours de l'évolution, la phosphorylation est devenue l'un des types les plus importants de modification post-traductionnelle (PTM) en raison de sa polyvalence et de sa réversibilité immédiate. La phosphorylation des protéines, qui peut se produire sur neuf des 20 acides aminés des protéines, est facilement catalysée par les protéines kinases dans des conditions physiologiques, en utilisant l'ATP comme donneur de phosphate (le guanosine triphosphate (GTP) et le phosphoénol pyruvate (PEP) peuvent également servir de phosphate donateurs). La phosphorylation est facilement inversée grâce à l'hydrolyse catalysée par des enzymes par les protéines phosphatases, qui accélèrent la vitesse de réaction de plusieurs milliers de fois.

La phosphorylation des protéines est l'une des PTM les plus courantes chez les eucaryotes. Les esters phosphates de Ser, Thr et Tyr prédominent chez les eucaryotes, mais la phosphorylation de six autres acides aminés est chimiquement réalisable (arginine (Arg), lysine (Lys), histidine (His), cystéine (Cys), aspartate (Asp) et glutamine ( Glu)), et dans de nombreux cas est connu pour se produire. La phosphorylation de His, Lys et Arg pour générer des liaisons phosphoramidate « à haute énergie » peut avoir été importante dans des conditions prébiotiques. En effet, le phosphate d'Arg est utilisé comme composé de stockage d'énergie dans les plantes. La phosphohistidine (P.His) est chimiquement instable et a une demi-vie relativement courte en solution aqueuse à pH 7, mais la phosphorylation de His est utilisée comme mécanisme de régulation chez les eucaryotes supérieurs [6]. De plus, P.His est utilisé comme intermédiaire dans le transfert de phosphate aux protéines par un grand nombre de systèmes de signalisation procaryotes à deux composants dans lesquels une protéine biocapteur catalytique phosphoryle une protéine régulatrice de réponse sur un Asp, transmettant ainsi un signal, transduisant généralement un entrée extracellulaire au niveau de la membrane dans l'activation d'un facteur de transcription. Dans ces systèmes, la haute énergie de la liaison phosphoramidate P.His générée sur le biocapteur en réponse à l'entrée de signal entraîne le couplage du phosphate au groupe β-COOH d'Asp, formant une liaison anhydride mixte.

4. Pourquoi la phosphorylation des protéines est-elle si importante ?

La caractéristique critique des acides phosphoaminés dans les protéines est qu'ils agissent comme Nouveau des entités chimiques qui ne ressemblent à aucun acide aminé naturel, et permettent ainsi de diversifier la nature chimique des surfaces protéiques. En particulier, le groupe phosphate, avec sa grande enveloppe hydratée et sa charge négative supérieure à 1, est chimiquement tout à fait distinct des seuls acides aminés chargés négativement, Asp et Glu, dont les chaînes latérales carboxyles n'ont qu'une seule charge négative et une plus petite coquille que le phosphate. Pour cette raison, il a été suggéré qu'une paire vicinale de résidus Asp ou Glu pourrait constituer une meilleure mutation phosphomimétique qu'un seul Asp ou Glu, car cela générerait une double charge négative locale [7].

Un groupe phosphate lié à une protéine peut former des liaisons hydrogène ou des ponts salins intra- ou intermoléculaires. En particulier, le groupe phosphate est bien adapté pour interagir avec le groupe guanidino d'Arg, qui a une structure plane rigide qui peut créer des liaisons hydrogène dirigées avec le groupe phosphate doublement chargé à pH physiologique. En raison de la densité plus élevée de charge négative et de la plus grande enveloppe hydratée, les phosphoaminoacides forment des liaisons hydrogène et des ponts salins plus forts et plus stables que Asp ou Glu avec Arg [8]. De cette manière, un seul phosphate est capable d'exercer des effets intra- ou intermoléculaires. Les phosphates de protéines peuvent agir de manière stérique ou ionique pour réguler la fonction ou l'interaction d'une autre protéine ou petite molécule, ou plus communément pour provoquer un changement de conformation au sein d'un monomère protéique ou une transition allostérique au sein d'un multimère protéique. Les propriétés uniques de taille et de charge du phosphate lié de manière covalente permettent également une reconnaissance spécifique et inductible des phosphoprotéines par des domaines de liaison phosphospécifiques dans d'autres protéines, favorisant ainsi l'interaction protéine-protéine inductible. En effet, la capacité d'un phosphate dans un contexte de séquence spécifique à générer un site de liaison phosphodépendant pour une autre protéine est sans doute la fonction la plus importante de la phosphorylation des protéines. Les interactions protéiques dépendantes de la phosphorylation sont cruciales pour la transduction des signaux de manière intracellulaire, mais la phosphorylation peut également provoquer un changement dans l'emplacement subcellulaire d'une protéine ou créer un phosphodegron, conduisant à une dégradation de la protéine dépendante de l'ubiquitine.

5. Pourquoi le phosphate a-t-il été préféré à d'autres molécules pour la modification des protéines ?

Plusieurs éléments à proximité du phosphore dans le tableau périodique forment des polyoxyanions. Le sulfate (le soufre est dans le groupe 16 à côté du phosphore) peut également former des esters aryliques et hydroxylés aromatiques, qui ont une énergie libre d'hydrolyse élevée, et il existe des exemples d'esters sulfatés en biologie, y compris les Tyrs sulfatés dans les protéines sécrétées. Cependant, l'énergétique de la sulfatation n'est pas aussi favorable et le sulfate ne contient que deux oxygènes ionisables, tous deux ayant un pKas inférieur à pH 2, ce qui signifie que les monoesters sulfatés conservent toujours une seule charge négative. De plus, les diesters d'alkylsulfate non seulement manquent de charge négative, mais sont également instables et ont la propriété indésirable d'alkyler les molécules biologiques (par exemple le méthanesulfonate de méthyle). L'orthosilicate (le silicium est dans le groupe 14 à côté du phosphore) est également très abondant sur Terre, mais son pKa le plus bas est de 9,5 et ses esters sont extrêmement instables en solution aqueuse.

D'un point de vue chimique, l'arséniate est l'alternative la plus plausible au phosphate. L'arsenic, comme le phosphore, appartient au groupe 15 et l'arséniate (V) a des propriétés de formation d'esters et des pKas (2,1, 6,9 et 11,5) similaires à ceux du phosphate. Comme le phosphate, l'arséniate peut former des mono-, di- et triesters. Cependant, les triesters et diesters d'arséniate sont très instables en solution aqueuse (la demi-vie d'un triester d'arséniate est inférieure à 0,02 s dans l'eau à pH 7 et à température ambiante, et les diesters sont encore moins stables) [9]. De même, on s'attendrait à ce que les précurseurs d'acide nucléique, tels que l'adénosine triarsenate, soient très labiles. De plus, l'arséniate a des propriétés chimiques indésirables, y compris la réaction avec les groupes thiol de la cystéine. Enfin, les longueurs de liaison As–O sont environ 10 % plus longues que les longueurs de liaison P–O et, par conséquent, le rayon de est environ 10 % plus grand que celui de . De plus, la charge négative partielle sur les atomes d'oxygène P–O est d'environ 6 % supérieure à celle de As–O. Ces différences chimiques modifieraient la structure et les propriétés des macromolécules utilisant des diesters d'arséniate comme liaisons.

Pour ces raisons, un rapport récent affirmant qu'une halobactérie isolée de Mono Lake en Californie, aux États-Unis, est capable d'utiliser de l'arséniate au lieu du phosphate était surprenant [10]. Il est affirmé que l'arséniate est incorporé dans l'ADN, l'ARN, les lipides et les protéines (80 % du total) dans cet organisme sur la base d'un marquage à l'arséniate radioactif et de divers types d'analyses physiques. Cependant, l'analyse de l'ADN a montré qu'il y avait encore du phosphate dans l'ADN des cellules isolées des cellules cultivées dans un milieu d'arséniate sans phosphate ajouté, probablement dérivé du phosphate contaminant dans les produits chimiques utilisés dans le milieu de croissance. Aucune preuve directe n'a été présentée que l'ADN a des liaisons diester arséniate, ou que les protéines sont arsenylées sur Ser, Thr et Tyr.Une analyse plus approfondie de cet organisme est nécessaire pour déterminer dans quelle mesure l'arséniate peut se substituer au phosphate pour maintenir la vie et modifier les protéines par estérification [9].

6. Code

Le groupe phosphate a des propriétés spéciales qui peuvent être exploitées pour réguler des fonctions biologiques critiques lorsqu'elles sont attachées à des protéines. Le groupe phosphate sert de commutateur pour favoriser les interactions protéine-protéine inductibles, ce qui permet aux réseaux de transduction de signaux de transmettre des signaux transitoires en réponse à des stimuli extracellulaires. Le phosphate a des propriétés chimiques presque idéales pour la formation de polymères biologiques et, en particulier, pour la modification des protéines. La vie telle que nous la connaissons n'aurait pas pu évoluer sans phosphate.


Remerciements

Les auteurs tiennent à exprimer leur gratitude aux personnes et institutions suivantes :

Prof. Iliakis (Universitätsklinikum Essen, Essen, Allemagne) pour avoir fourni les données de l'expérience d'interaction ADN-protéine (Figure 6) Karsten Meyenberg et Prof. Ulf Diederichsen (Institut für Organische und Biomolekulare Chemie, Georg-August-Universität Göttingen, Göttingen, Allemagne), Geert van den Bogaart et Reinhard Jahn (Max-Planck-Institut für biophysikalische Chemie, Göttingen, Allemagne) pour les expériences sur les liposomes (7) et Krishna Saxena (Johann Wolfgang Goethe-Universität, Francfort, Allemagne) pour les études de liaison de l'inhibiteur et du traceur p38 (Figues. 3 et 4). La sous-unité catalytique de PKA et l'inhibiteur thermostable PKI étaient des cadeaux aimables de F.W. Herberg (Université de Kassel, Kassel, Allemagne) et B. Zimmermann (Biaffin GmbH & Co KG, Kassel, Allemagne) (5) soutenu par le projet collaboratif européen FP7 Affinity Proteome (contrat 222635).

Sergey Tarasov (NCI Frederick) est remercié pour les discussions fructueuses sur les études d'interaction biomoléculaire.

Les expériences détaillées dans Figure 6 ont été réalisées à l'Institut de biologie des radiations médicales, Université de Duisberg-Essen, Essen, Allemagne.

Le travail a été soutenu par le ministère fédéral de l'Éducation et de la Recherche, Allemagne, Hightech Strategie "KMU-Innovativ: Biotechnologie-Biochance" (Grant No: FKZ 0315376).

Le Center for Nanoscience (CeNS) et la Nanosystems Initiative Munich (NIM) ont soutenu ce travail.


Voir la vidéo: LATP - adénosine triphosphate (Juillet 2022).


Commentaires:

  1. Gujin

    Quelle phrase nécessaire ... super, la belle idée

  2. Doubar

    Je ne sais pas quel type d'armes avec la guerre du Troisième Guerre mondiale se déroulera, mais le quatrième - avec des bâtons et des pierres.

  3. Kajisar

    C'est dommage que je ne puisse pas parler maintenant - je suis en retard pour la réunion. Mais je reviendrai - j'écrirai certainement ce que je pense sur cette question.

  4. Wilmar

    À mon avis, vous admettez l'erreur. Je peux le prouver. Ecrivez moi en MP, on discutera.

  5. Marcas

    Merci beaucoup pour votre soutien, comment puis-je vous remercier ?



Écrire un message